ID: 995084063

View in Genome Browser
Species Human (GRCh38)
Location 5:108087081-108087103
Sequence AACACTCTGGTGAATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995084056_995084063 15 Left 995084056 5:108087043-108087065 CCATACACTGTCCATGCACTGAA 0: 1
1: 0
2: 0
3: 11
4: 161
Right 995084063 5:108087081-108087103 AACACTCTGGTGAATGGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
995084059_995084063 4 Left 995084059 5:108087054-108087076 CCATGCACTGAATAGGACAAGGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 995084063 5:108087081-108087103 AACACTCTGGTGAATGGAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995084063 Original CRISPR AACACTCTGGTGAATGGAGC TGG Intronic
903456094 1:23487970-23487992 AACAATCTGGTGCAAGGAGTGGG - Intergenic
903945230 1:26958741-26958763 CACACGCTGGTCCATGGAGCTGG - Intronic
904398115 1:30236632-30236654 AAGACTCTGGGGAAAAGAGCAGG + Intergenic
905478605 1:38246090-38246112 GACACTTTGCTGAATGGAGCTGG + Intergenic
909905012 1:81183978-81184000 AAGTCTCTGGGGAATGGATCTGG + Intergenic
912044485 1:105437273-105437295 CTCACTCTGGTCCATGGAGCTGG - Intergenic
915806812 1:158862426-158862448 AAGATTTTGGTGAATGGAGTGGG - Intergenic
919695823 1:200574222-200574244 AGAACTTTGGTGGATGGAGCTGG - Intronic
920787893 1:209060186-209060208 AGCACTGTGGAGACTGGAGCGGG + Intergenic
921251845 1:213305529-213305551 AACACTCAGCTGAACGGAGTTGG - Intergenic
922486141 1:225974714-225974736 TACACCCACGTGAATGGAGCTGG + Intergenic
1064241526 10:13633881-13633903 AACCCTCTGGGGACTGGCGCTGG - Intronic
1065631306 10:27683781-27683803 AAGACTCTGGTGAGTAGGGCAGG + Intronic
1068619004 10:59156888-59156910 AACACTCTGGTTAATGTGTCAGG - Intergenic
1072940566 10:99760097-99760119 AACACACTGGTGTAAGGAGTGGG + Intergenic
1074046916 10:109847851-109847873 AATCCTATGTTGAATGGAGCAGG - Intergenic
1075476470 10:122739108-122739130 CACACTCTGGGGAGTGGTGCAGG - Intergenic
1080032469 11:27676372-27676394 AAAAGTGTGGTAAATGGAGCCGG - Intronic
1081252490 11:40851883-40851905 AAAACTCTGGTGGAAGGAGAAGG - Intronic
1083034850 11:59627529-59627551 ATCACTCTGCTGTATGGAGATGG - Intergenic
1083737701 11:64691062-64691084 CTCACTGTGGTGAATGAAGCAGG - Intronic
1084865184 11:72050058-72050080 AATACTCTGTTGAAAGGAGGAGG + Intronic
1085131953 11:74047680-74047702 AAGACTCTGGTGTAGGCAGCGGG + Intronic
1085696513 11:78709427-78709449 GACAGTCTAGTGAATGGAGCAGG - Intronic
1086563617 11:88198051-88198073 AACACGCTGATGTATGGTGCTGG + Intergenic
1086589001 11:88489398-88489420 AATACACTGGGGAAAGGAGCAGG + Intergenic
1088591648 11:111408519-111408541 AACCCTCTCTTGAATGGTGCAGG - Intronic
1088753544 11:112866120-112866142 AAAATTCTGGTGAAAGGAGCTGG - Intergenic
1089112047 11:116064874-116064896 AACTCTCTGGTGGGAGGAGCAGG + Intergenic
1091302791 11:134518224-134518246 AAGACTGTGGGGACTGGAGCTGG + Intergenic
1092124291 12:6064823-6064845 AACCCTCTGATGTTTGGAGCTGG - Intronic
1092675533 12:10914651-10914673 AAAACTCTGACAAATGGAGCTGG - Intronic
1096461470 12:51823562-51823584 AACACTCTGGTAAGGGGATCTGG + Intergenic
1096844877 12:54400957-54400979 CACACCCTGGCTAATGGAGCTGG + Exonic
1099560468 12:84167051-84167073 AACATTTTGATGAATGGAGTTGG + Intergenic
1102203990 12:111077687-111077709 AACACTCTTGTAAATAAAGCTGG - Intronic
1104440878 12:128792161-128792183 ACCAGTCTGGTGATTGGAGTGGG - Intergenic
1104738782 12:131157473-131157495 AACACTCATGTGAAGGAAGCTGG + Intergenic
1105433470 13:20358092-20358114 ATCACTCTGCTGGATGGTGCTGG + Intergenic
1105946324 13:25192835-25192857 AACATTATGGTGGATGGAACTGG + Intergenic
1106398711 13:29406709-29406731 AACATTCTTGGGAATGCAGCAGG - Intronic
1107560170 13:41551165-41551187 GACTTTCTGGTGAAGGGAGCTGG + Intergenic
1114262569 14:21048755-21048777 AAACCTGTGATGAATGGAGCAGG + Intronic
1114333799 14:21665762-21665784 AACACTCAGCTGAAGGGCGCCGG + Exonic
1116034017 14:39606403-39606425 AACACTCTGGTGATCAGAGTGGG - Intergenic
1116160135 14:41257477-41257499 AACACTCTTGATAATGGAGCTGG - Intergenic
1117267836 14:54108813-54108835 AACACCAGGGAGAATGGAGCTGG + Intergenic
1118995478 14:70831812-70831834 ACCACTCTGGTGAATGCATAAGG + Intergenic
1121606980 14:95247695-95247717 AACAATGTGGTCAATGGATCAGG + Intronic
1123173377 14:106395674-106395696 AAAACTCTGCTGAATGAAGCTGG - Intergenic
1124653003 15:31486665-31486687 AGCACACTGGTGGGTGGAGCTGG - Intronic
1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG + Intergenic
1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG + Intronic
1133696617 16:8269557-8269579 AACACTATGGTGAATAGAAGTGG + Intergenic
1134139280 16:11703183-11703205 AACACCATGGTGAATGGGACAGG + Intronic
1135010199 16:18869585-18869607 AACACTTTGGGGAATGGGGTGGG - Intronic
1136313865 16:29436913-29436935 AACACTTTGGGGAATGGGGTGGG - Intergenic
1136327305 16:29538678-29538700 AACACTTTGGGGAATGGGGTGGG - Intergenic
1136441993 16:30278664-30278686 AACACTTTGGGGAATGGGGTGGG - Intergenic
1138318362 16:56089845-56089867 AATCCTCTGGTGACAGGAGCAGG + Intergenic
1138729732 16:59182059-59182081 AACACTCTGATGACAGGTGCTGG + Intergenic
1138980856 16:62266481-62266503 AACACTCTGGGGGCTGAAGCAGG + Intergenic
1140977298 16:80072273-80072295 AACACTCTTATGGAGGGAGCGGG - Intergenic
1144665110 17:17097044-17097066 AACATTCTGGGGTGTGGAGCAGG + Intronic
1145477030 17:23625689-23625711 AACATTCCTTTGAATGGAGCAGG + Intergenic
1145550254 17:24691202-24691224 AACATTCCTTTGAATGGAGCAGG + Intergenic
1145554043 17:24746162-24746184 AACACTCCTTTGGATGGAGCAGG + Intergenic
1145555015 17:24760242-24760264 AACATTCCTTTGAATGGAGCAGG + Intergenic
1145567529 17:24942077-24942099 AACATTCTTTTGGATGGAGCAGG + Intergenic
1145637530 17:25960309-25960331 AACATTCCGTTGGATGGAGCAGG + Intergenic
1145651526 17:26163755-26163777 AACATTCCTTTGAATGGAGCAGG + Intergenic
1146255122 17:31387797-31387819 AACCCTATTGTGAATGGCGCAGG + Intergenic
1146526463 17:33571076-33571098 ATTAGTCTGGTGAATGGAACAGG - Intronic
1146665154 17:34696303-34696325 AACACTCTGGGGGATGAAGGTGG + Intergenic
1149199283 17:54164003-54164025 AACACTATGTTGAATAGGGCTGG - Intergenic
1149714680 17:58776983-58777005 AACACTTTGGAGGATGAAGCAGG + Intronic
1150002343 17:61449407-61449429 AACTCTTTGGTGAATGGTGAAGG - Intergenic
1152350327 17:79780673-79780695 AACATTTTGGTGGATGGAGAAGG - Intronic
1152889018 17:82869573-82869595 AACCCACTTTTGAATGGAGCTGG + Intronic
1155792244 18:29987826-29987848 AGCACTCTGGTGAAAAAAGCAGG + Intergenic
1159103990 18:63984860-63984882 AACAGTTTGGTAAATGGAGAAGG - Intronic
1160020686 18:75178475-75178497 AACAGTCTGATGATTGGTGCTGG + Intergenic
1163439737 19:17316075-17316097 AGGACTCTAGTGATTGGAGCAGG + Intronic
1168136362 19:54354966-54354988 AACAGTCAGGTGAATAAAGCTGG + Exonic
1168179938 19:54655060-54655082 AACAGTCAGGTGGATGTAGCCGG - Intronic
927189776 2:20509667-20509689 ATCCCTCTGTGGAATGGAGCAGG + Intergenic
930929367 2:56861981-56862003 AACACTCTGATGGAAGGTGCCGG + Intergenic
932075887 2:68662601-68662623 AACACACTGGGGAACAGAGCTGG - Intergenic
932853491 2:75210524-75210546 AACACTCTGATGAGTGGTGCTGG + Intergenic
933472800 2:82748523-82748545 AACACTATGGTGAATGGAAGTGG + Intergenic
934606068 2:95696331-95696353 AACACTCTCCTAGATGGAGCTGG - Intergenic
935794084 2:106623967-106623989 AACTCTCTGGGGAAAGGAGGAGG + Intergenic
936539482 2:113338544-113338566 AACACTCTGCTAGATGGAGCTGG - Intergenic
938303920 2:130237089-130237111 AACACACTGGTGAGGGGACCAGG + Intergenic
938452761 2:131437196-131437218 AACACACTGGTGAGGGGACCAGG - Intergenic
938774729 2:134531478-134531500 AACACCCTGGGGCTTGGAGCTGG - Intronic
940204825 2:151191270-151191292 GGCTCTCTGTTGAATGGAGCAGG - Intergenic
941613686 2:167694041-167694063 AAAGCTATGGTGACTGGAGCAGG + Intergenic
942548136 2:177086065-177086087 ATCACTCTGCTGTATGCAGCTGG + Intergenic
943825512 2:192386096-192386118 AACACTGTGTTGAATAGAACTGG + Intergenic
945898494 2:215512190-215512212 AACACACTGGTGAGAGGATCTGG + Intergenic
947972661 2:234337088-234337110 AAAACTCAGGTGACTGGAGAAGG + Intergenic
948679900 2:239626677-239626699 AACACACTGGGGAGGGGAGCTGG - Intergenic
948826835 2:240577090-240577112 CACATTCTGGAGAATGGGGCGGG + Intronic
1168926957 20:1589432-1589454 AACACAGTGGTGAATGAAGTAGG - Intronic
1169557890 20:6768785-6768807 AAAACTCTGGTCAAAGGACCTGG - Exonic
1173358051 20:42313756-42313778 AGCACTCTGATGTATTGAGCAGG - Intronic
1174592244 20:51655340-51655362 AGCACTCTGGGAGATGGAGCCGG + Intronic
1177624858 21:23646558-23646580 CTCACTCTGGTCCATGGAGCTGG + Intergenic
1179887124 21:44318968-44318990 AACACTGGGGTGGCTGGAGCAGG + Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955498307 3:59559738-59559760 AGCACTCTCCTGAATGGAGAGGG - Intergenic
955642319 3:61098948-61098970 AACACTATGTTGAATGGATGTGG + Intronic
959670664 3:108973473-108973495 AATTCTCTGGTGTATGGTGCAGG - Intronic
960290251 3:115875634-115875656 AAGACTGTGGTCAAAGGAGCAGG + Intronic
960343619 3:116505576-116505598 CACACTCTGGGGAATGTTGCAGG - Intronic
964259725 3:154822010-154822032 AACACTATGTTGAATGGAAGTGG + Intergenic
964397227 3:156258179-156258201 AACACTCTCATTGATGGAGCTGG + Intronic
965331407 3:167379304-167379326 TACACTCTGGTGAAGGAAGTAGG + Intronic
966256348 3:177920098-177920120 AAGACTCTGTTGAATCAAGCTGG + Intergenic
967185885 3:186944251-186944273 AACACTTTGGGGACTGGAACAGG + Intronic
969904850 4:10384315-10384337 AACACTGCAGTGAATGCAGCAGG - Intergenic
971657213 4:29364355-29364377 AACATTCTGCAGAATGGAGTTGG - Intergenic
973957829 4:56080738-56080760 AACAATCTGCTGAAGGGAGAGGG - Intergenic
977025622 4:91815585-91815607 AAAACTCTGCTGTATGGAACAGG - Intergenic
978359909 4:107920107-107920129 AATACTATGTTGAATGGAGGTGG - Intergenic
984933144 4:184866263-184866285 AACACTCTGGTGTATGAAAATGG + Intergenic
985810496 5:2080035-2080057 TACACTCTGGAGAATGAGGCTGG + Intergenic
988023350 5:25652218-25652240 AACACTCTGTTGAATAGGGGTGG + Intergenic
988271326 5:29021371-29021393 AACTCTCTATTAAATGGAGCCGG - Intergenic
988839060 5:35065594-35065616 GCCACTCTGTTGAATGAAGCAGG - Exonic
991685260 5:69176133-69176155 AACACTTTGGTAAGTGGAGGTGG - Intronic
992736432 5:79726609-79726631 CACACTAGGGTGAATGGATCTGG + Intronic
994821029 5:104651419-104651441 AACACTCTGGAGAATGGAAATGG - Intergenic
995084063 5:108087081-108087103 AACACTCTGGTGAATGGAGCTGG + Intronic
996146106 5:119979029-119979051 AAAACTCTGGAAAATGGAGTAGG - Intergenic
998272871 5:140723429-140723451 AAAAATCAGGTAAATGGAGCTGG - Intergenic
998660099 5:144227171-144227193 AACACTATGGAGAATGAAGCAGG + Intronic
999381808 5:151126637-151126659 AGGACTCTGGCGAATGGAGGAGG - Intronic
1003437198 6:6101710-6101732 AACACTATGTTGAATAGAGGTGG + Intergenic
1004308479 6:14522568-14522590 AACACTCTGGTCATTGGCTCAGG + Intergenic
1005031089 6:21509812-21509834 AAAAATCTGTTGAATGGAGCTGG - Intergenic
1008935516 6:56987671-56987693 GACATTCTGGTGCATGGAGGAGG - Intronic
1018537398 6:164836084-164836106 AAAACCCTGACGAATGGAGCCGG + Intergenic
1020706161 7:11546321-11546343 AACACTCTGATGGAGGGTGCTGG - Intronic
1022893531 7:34725652-34725674 AACAATCTGGTGAAAACAGCTGG - Intronic
1023610759 7:41968049-41968071 TATGTTCTGGTGAATGGAGCTGG + Intronic
1024452135 7:49559642-49559664 AACACTATGTTGAATGGCACTGG + Intergenic
1026790787 7:73330154-73330176 TACACTGTGGGGCATGGAGCTGG + Exonic
1027570214 7:79856815-79856837 AACCCTCTAATGAATGGAGAGGG - Intergenic
1029025409 7:97412021-97412043 AAGACTCAGGTGACTGGACCTGG + Intergenic
1029591197 7:101508152-101508174 AACACACTGGAGCATGGAGGTGG + Intronic
1032805764 7:135352763-135352785 AACACTTTGGGGAATGTAACAGG - Intergenic
1036723281 8:11198627-11198649 AACATTTAGGTGAATGGAGGTGG + Intronic
1036742817 8:11380426-11380448 ACCACTCTGGTGCCTGGTGCTGG - Intergenic
1039253860 8:35696798-35696820 GACACTCTGGAGAATGGGGAAGG - Intronic
1041821014 8:62032937-62032959 AACTCTCTGGTGCTTGGGGCTGG - Intergenic
1044526904 8:93262536-93262558 AGCTCTCTTGGGAATGGAGCAGG - Intergenic
1047892708 8:129330344-129330366 TTCACTCTGGGGGATGGAGCTGG + Intergenic
1049234204 8:141503333-141503355 AAAACTCTGATAAATGGGGCTGG + Intergenic
1049989538 9:977912-977934 AACACTCGGCTGAGTCGAGCTGG + Intronic
1050465675 9:5920616-5920638 AAATCCCTGGTGAATGGAACTGG + Exonic
1050747686 9:8896067-8896089 AACACTCTGATGTGTGGAGTTGG - Intronic
1051101841 9:13530985-13531007 CACAGTTTGGTGAATGGAGTGGG + Intergenic
1052200117 9:25767984-25768006 AACACTCTGTTGAATAGAAGTGG - Intergenic
1055477165 9:76674017-76674039 AACACTATGTTGAATAGAGGTGG - Intronic
1056007749 9:82290799-82290821 AATACTCTGGTCACTGTAGCTGG + Intergenic
1058426913 9:104883307-104883329 AACATGGTGATGAATGGAGCTGG - Intronic
1059350022 9:113658017-113658039 ACCACTCTGATGAATGGAGAAGG - Intergenic
1060154414 9:121309221-121309243 ACAACTCTGGGGCATGGAGCTGG + Intronic
1203361701 Un_KI270442v1:222245-222267 ATCGCTGTGGTGAATGGAGGAGG + Intergenic
1189692764 X:43634374-43634396 AAGACTCTTGTCAATGGAGAAGG - Intergenic
1191646066 X:63482430-63482452 AACACTCTGTTGAATAGAAGTGG - Intergenic
1192424106 X:71060416-71060438 AGCAGTCTGTTGTATGGAGCAGG - Exonic
1196707657 X:118729549-118729571 AACACTCTGAGGATTAGAGCTGG - Intronic
1198018146 X:132632479-132632501 AGCACGCTGGGGAATGCAGCTGG + Intronic
1201352745 Y:13063739-13063761 AAAACTATGATGAATGGAACTGG - Intergenic