ID: 995086121

View in Genome Browser
Species Human (GRCh38)
Location 5:108111905-108111927
Sequence CTGTTGACACACATTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995086119_995086121 14 Left 995086119 5:108111868-108111890 CCCAGTATATAGATCATGTTAGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG No data
995086120_995086121 13 Left 995086120 5:108111869-108111891 CCAGTATATAGATCATGTTAGCA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995086121 Original CRISPR CTGTTGACACACATTGAACA AGG Intronic
No off target data available for this crispr