ID: 995095001

View in Genome Browser
Species Human (GRCh38)
Location 5:108225428-108225450
Sequence AAGTTGTACTGGAGTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995094997_995095001 9 Left 995094997 5:108225396-108225418 CCAATAGTGAAGTAAATAGTTAA 0: 1
1: 0
2: 0
3: 21
4: 238
Right 995095001 5:108225428-108225450 AAGTTGTACTGGAGTGAAGTGGG 0: 1
1: 0
2: 2
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995095001 Original CRISPR AAGTTGTACTGGAGTGAAGT GGG Intronic
900479440 1:2891023-2891045 AAGTTGTATTGGAGTAGGGTGGG - Intergenic
900908930 1:5580425-5580447 TAGTTGAAATGGAGTCAAGTGGG - Intergenic
901140355 1:7025326-7025348 AAGTTGTACTGCAGAGAGGAAGG + Intronic
904116154 1:28163476-28163498 GAGCTGTACTGGGGTGGAGTGGG + Intronic
906923631 1:50091000-50091022 AAGTCCTACTGGAGTAAGGTGGG + Intronic
907794033 1:57696366-57696388 AAGTTGAACTGTGGTGCAGTTGG + Intronic
908746395 1:67380889-67380911 AAGTTATACTGGAGTAGAGTGGG - Intronic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
913041135 1:115025097-115025119 AAATAATACTGGAGTAAAGTAGG - Intergenic
919109601 1:193201123-193201145 AAGTTGTACTGTACTGACCTTGG + Intronic
920086547 1:203421648-203421670 AAGTTCCACTGGAGAGCAGTAGG + Intergenic
920136679 1:203775068-203775090 AAGTTGGAGTGGAGTGGGGTGGG + Exonic
921686065 1:218090535-218090557 AGATAGTACTGGAGTGGAGTAGG + Intergenic
923797003 1:237166737-237166759 AAATTGTACTGCAGTGCAGAAGG + Intronic
924162781 1:241251439-241251461 AAGTTTGCCTGGAGTGAAGAAGG + Intronic
1064894456 10:20218369-20218391 AAGGTGAACTGGAATAAAGTGGG + Intronic
1068251820 10:54452981-54453003 AGGTCGTACTGGAGTAGAGTAGG + Intronic
1069177639 10:65313142-65313164 AAGTTGTACAGGAGTGAGTCAGG + Intergenic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070751176 10:78964912-78964934 AGGCTGTTCTGGAGAGAAGTAGG + Intergenic
1072504686 10:96053339-96053361 AAGTTGTTCTGGGATCAAGTGGG + Intronic
1072853822 10:98925531-98925553 AACTAATACTGCAGTGAAGTGGG + Intronic
1073793028 10:106958886-106958908 AAATTGTACTGAGGTGGAGTAGG - Intronic
1074958432 10:118415809-118415831 AACTTGTGCTGGAGAAAAGTTGG - Intergenic
1075935756 10:126339810-126339832 AAATTTTATTTGAGTGAAGTGGG + Intronic
1076105037 10:127815052-127815074 AAGTAGTGCTGGTGTGAAGGTGG - Intergenic
1077274326 11:1696568-1696590 AGGTTGTACTGGAGTAGGGTGGG + Intergenic
1079592928 11:22202867-22202889 AAGTTATACTGGATTTAAGGTGG - Intronic
1079756942 11:24275751-24275773 GAGTTGTACTGGACTAAATTAGG - Intergenic
1079982843 11:27169545-27169567 AATTCCTACTGGAGTGAGGTAGG + Intergenic
1080848045 11:36043559-36043581 AGGTTGTACTGGAGTAGGGTGGG + Intronic
1083462393 11:62822927-62822949 AGGGTGTACTGGAGGGATGTAGG - Intronic
1089800844 11:121025073-121025095 AAGTTGTAGTTGAGGAAAGTTGG + Intronic
1090370058 11:126244199-126244221 ATGTTGGACAGGAGTGGAGTGGG - Intronic
1093588025 12:20865892-20865914 AATTTTTACAGCAGTGAAGTAGG - Intronic
1093636945 12:21481880-21481902 AAATGTTACTGAAGTGAAGTGGG + Intronic
1095803986 12:46297912-46297934 AAGTTGTAATGGGATGAAGCGGG - Intergenic
1097376061 12:58844399-58844421 AAGACCTACTGGAGTGAAGAGGG + Intergenic
1097750918 12:63351610-63351632 AAGTTGTCCTAGAATGAAGGGGG + Intergenic
1098024115 12:66184852-66184874 TAGTTTTAGTGGAGTAAAGTGGG + Intergenic
1099197685 12:79638566-79638588 AATTTGTTGTGTAGTGAAGTTGG + Intronic
1100790159 12:98121440-98121462 AAACTGTACTGGAGAAAAGTAGG - Intergenic
1101920984 12:108932799-108932821 ATGTTCTACTAGAGTCAAGTTGG - Intronic
1102035839 12:109769943-109769965 AAGATGTATTGGAGGGAAGGGGG - Exonic
1102782970 12:115581413-115581435 AAGTTCAACTGGATTGAATTGGG - Intergenic
1105959985 13:25324143-25324165 TATTTGTACTGGAGTGGGGTGGG + Intronic
1107690603 13:42949076-42949098 ATGCTGTACTGGAGTCAGGTTGG - Intronic
1108432376 13:50367287-50367309 AAGTCGTACTGGAGTAGGGTGGG + Intronic
1108855272 13:54785864-54785886 AGATTATATTGGAGTGAAGTTGG + Intergenic
1109620552 13:64899897-64899919 CAGCTGCTCTGGAGTGAAGTAGG + Intergenic
1111182311 13:84685413-84685435 AAGTTGTATTGTAGTGAAGTGGG + Intergenic
1112239193 13:97664257-97664279 AGGTTCTACTGGTGTGTAGTGGG - Intergenic
1112721625 13:102252320-102252342 AAGTTGTACAGCAGTTAAGTGGG - Intronic
1119348104 14:73942805-73942827 AAGTGTTACTGGAGGCAAGTAGG + Intronic
1120810990 14:88803275-88803297 AATTCATACTGGAGTGAGGTGGG + Intergenic
1122661072 14:103295677-103295699 ACGTTGTACAGGTGTGTAGTAGG - Intergenic
1122988608 14:105225516-105225538 ATGTTGTACTAGAGTCAGGTTGG - Intronic
1124039726 15:26089853-26089875 AAGTTTTACTGCAGTGAGGATGG + Intergenic
1127221457 15:56885439-56885461 AAGTTGTCCGAGATTGAAGTGGG - Intronic
1128198364 15:65781063-65781085 AAGTTGTAAAGGAGTTAGGTAGG + Intronic
1128648797 15:69395884-69395906 AAAGTGGGCTGGAGTGAAGTTGG + Intronic
1133655444 16:7858345-7858367 AAGTTGTAGTGAAGTGAGGCTGG - Intergenic
1139589500 16:67925745-67925767 AAGTTTTACTGAGCTGAAGTGGG - Intronic
1143701245 17:8661882-8661904 AAGTCGTACTGGATTAAGGTAGG - Intergenic
1145763993 17:27445402-27445424 AGGTGGGACTGGAGTGATGTGGG - Intergenic
1146521548 17:33529260-33529282 TGATTGGACTGGAGTGAAGTGGG - Intronic
1146831618 17:36074456-36074478 AAGTTTTATTGGAATGCAGTTGG + Intergenic
1147270310 17:39265234-39265256 AAGGAGTACATGAGTGAAGTAGG - Intronic
1150955526 17:69855235-69855257 AAGTTGCAATGGAATGGAGTGGG - Intergenic
1151115597 17:71731690-71731712 AATTTGTATTGGACTGAATTTGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1151869521 17:76827006-76827028 AAGTTCTCCTGCAGAGAAGTAGG + Intergenic
1151881178 17:76895689-76895711 AGGTCATACTGGAGTGAAGTGGG - Intronic
1154006576 18:10534702-10534724 AAAATGTATTGGAGTGAACTGGG + Intronic
1155520910 18:26668157-26668179 AAGTTTCACTGATGTGAAGTTGG - Intergenic
1157255879 18:46138788-46138810 TAGTTGTACTGCAGTCTAGTGGG + Intergenic
1158668814 18:59456371-59456393 AAGTTATACTGGAGTAAGATGGG + Intronic
1160067083 18:75585421-75585443 AAGTTGTGCTGGAGTAGGGTGGG - Intergenic
1163991623 19:21003906-21003928 AGGTTGTATTGGAGTGTTGTAGG - Intergenic
925780712 2:7379333-7379355 AAGTCATCCTGGAGTGAGGTGGG + Intergenic
926025221 2:9537241-9537263 AATTTGTACTTGTGTGAAGTGGG - Intronic
930246791 2:48991644-48991666 CAGTTGCACTTGAGTGAAGCTGG + Intronic
930285467 2:49422505-49422527 ATGTTATACTGGAGTCATGTTGG - Intergenic
933866465 2:86522706-86522728 AAGAGGTAATGGAGTGGAGTAGG - Intronic
935557717 2:104528493-104528515 AGTTTGTACTGGAGGGTAGTAGG - Intergenic
936968215 2:118148056-118148078 AAGTCATACTGGAGTAGAGTGGG - Intergenic
938764232 2:134449795-134449817 GATTTGGACAGGAGTGAAGTCGG + Exonic
939353319 2:141069167-141069189 AGGTAGTACTGGGGTGAAGTGGG - Intronic
939958604 2:148546951-148546973 AAGTTGTACTGGAGTACGGTGGG + Intergenic
941231476 2:162916464-162916486 AATTTGTACTGGACTGACCTGGG + Intergenic
941497606 2:166225700-166225722 AAGTCATACTGGAGTGGAGTGGG + Intronic
942973273 2:181982840-181982862 AAGTGATACTGGAGTAAAGATGG - Intronic
946827229 2:223691210-223691232 AAGTCGTACTGTAGTAGAGTGGG - Intergenic
1169109720 20:3024376-3024398 GAAATGGACTGGAGTGAAGTGGG + Intronic
1169991739 20:11512239-11512261 AAGTTGTACTAGGATGAAGTGGG - Intergenic
1172022460 20:31924229-31924251 ACGTTGGGGTGGAGTGAAGTGGG - Intronic
1172526443 20:35602744-35602766 AAGAAGTACTGAATTGAAGTGGG + Intergenic
1173387298 20:42600519-42600541 ATATTGTACAGTAGTGAAGTTGG + Intronic
1174530980 20:51213909-51213931 AAGATGTACAGGAGGAAAGTAGG - Intergenic
1177752238 21:25298598-25298620 AAGTGGTAGTGGAGTGGACTGGG + Intergenic
1182280322 22:29214606-29214628 AAGTTGGAGAGGAGAGAAGTTGG + Intronic
1185338781 22:50282559-50282581 AAGTGGATCTGGAGTGCAGTGGG + Intronic
949119262 3:366057-366079 AAGTTGTCCTGGAGTAAAGATGG + Exonic
949538934 3:5017307-5017329 AAGGTGGACAGGAGAGAAGTTGG + Intergenic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956534459 3:70260344-70260366 AAGTCGTACCGGAGTAGAGTGGG - Intergenic
956755471 3:72381690-72381712 AGGTTGTCCTGGAGTAAGGTAGG - Intronic
958056014 3:88412991-88413013 AAGTTTTAATGGATAGAAGTAGG + Intergenic
958699254 3:97567559-97567581 AAGTCCTACTGGAGTAAGGTGGG + Intronic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
962490662 3:135890907-135890929 AAGCTATACTGAAGGGAAGTAGG - Intergenic
963184179 3:142394478-142394500 AAGTTGAAGTAGAGTGAAGGAGG - Intronic
963649459 3:147959902-147959924 TAGTTTTACTGGGGAGAAGTAGG - Intergenic
964427788 3:156571367-156571389 AAGTAGCACTGGGGTGAAGCAGG + Intergenic
964830650 3:160880507-160880529 ATGTTTTACTGCAGTGAAGTGGG + Intronic
965410178 3:168320435-168320457 AGGTTGTACTGGAGTAGGGTGGG + Intergenic
966552696 3:181222771-181222793 AGTTTTTACTGGAGTAAAGTGGG + Intergenic
967075134 3:185994980-185995002 AAGTTGTACAGGAGTTACGATGG + Intergenic
967842877 3:194021004-194021026 AAGTCATACTGGATTGAAGTGGG + Intergenic
968679237 4:1905246-1905268 AAGTTCTTCTAGAGTGAAGTTGG + Intronic
969611688 4:8231220-8231242 CAGTTGTACTGGCGTGAAACTGG - Intronic
972466136 4:39358859-39358881 AAGTGGTACTGGGGTTAAGTAGG - Intronic
973103384 4:46300172-46300194 AAGTTGCTTTGGAGTGAAATAGG - Intronic
974422307 4:61692797-61692819 AAATTGTAATAGAGTGAATTGGG - Intronic
977179473 4:93856771-93856793 AAAGGGCACTGGAGTGAAGTGGG + Intergenic
978688437 4:111478262-111478284 AATGTGTACTGAAGTTAAGTAGG - Intergenic
979552823 4:122010178-122010200 AGGTTGTACTGGAGTAGGGTGGG - Intergenic
981348709 4:143703752-143703774 AAGTTGTCCTGAAGTGATGGGGG - Intergenic
982182421 4:152761218-152761240 AATTTAAAGTGGAGTGAAGTGGG + Intronic
982829755 4:160044599-160044621 CTGTTGTACTGGAGTGGAGTAGG + Intergenic
984025228 4:174535329-174535351 AAATTGTACTGAGGTGACGTTGG + Intergenic
984282997 4:177694690-177694712 AACTTGCACTGCAGTAAAGTGGG - Intergenic
984639498 4:182145261-182145283 AAGTTGAAAAGGAGTGAAGGAGG + Intronic
984821845 4:183889230-183889252 AGGTTGTACTGGAGTAGGGTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985305796 4:188538254-188538276 AGGTTGTAGTGGAGTGGAGTGGG + Intergenic
986470779 5:8072188-8072210 AAGTTATTCTGGAGTCACGTAGG + Intergenic
993011058 5:82483508-82483530 AAGATGGCCTGGAGTGCAGTGGG + Intergenic
993574292 5:89582177-89582199 AAGTTCTAGTGGATTGAAGCCGG - Intergenic
994180698 5:96762844-96762866 AATTTTTACTGGTGTGAATTGGG - Exonic
995095001 5:108225428-108225450 AAGTTGTACTGGAGTGAAGTGGG + Intronic
996872643 5:128208743-128208765 AAGTTGTACTGGAGAGCAGTAGG - Intergenic
996909418 5:128638181-128638203 AAGATTTACTGGAGTCATGTTGG - Intronic
998485588 5:142499113-142499135 AAGTTATACTGGATTGGAGTGGG - Intergenic
1000398255 5:160798365-160798387 AAATTATACTGGAGTAGAGTGGG + Intronic
1000682582 5:164204374-164204396 AAGGAATACTGGAGTAAAGTGGG + Intergenic
1004270241 6:14188743-14188765 AGTTTGTAATGTAGTGAAGTGGG + Intergenic
1005311164 6:24560791-24560813 AAGTTATACTGGAGTAGGGTGGG - Intronic
1005817906 6:29571514-29571536 AAGTTGTACTGGACTTTTGTGGG + Intronic
1007730330 6:43941565-43941587 AGGGTGCACTGGAGTGAAGGAGG + Intergenic
1010549809 6:77207755-77207777 AAATTGTATTCGAGTGAACTGGG - Intergenic
1012574156 6:100770466-100770488 ACATTGTACTGGAGTGCAATTGG + Intronic
1013958281 6:115866489-115866511 AAGTTGTACAGTTGTAAAGTAGG - Intergenic
1014303418 6:119711780-119711802 AAGTCATACTGGAGTAAGGTGGG - Intergenic
1014331771 6:120076500-120076522 AAGTTGTACTGCAGAGCAGTGGG - Intergenic
1015393989 6:132714933-132714955 AAGTTATACTGGAGTACAGTGGG - Intergenic
1016669188 6:146681485-146681507 AAGTTTTACTGGACTGTATTAGG - Intronic
1016699296 6:147035567-147035589 ATGTTATACTAGAGTCAAGTTGG + Intergenic
1016919625 6:149279114-149279136 AAGTTTAAGTGGAGTGATGTGGG - Intronic
1018231246 6:161677919-161677941 CAGTTGTACTGAAGTGAACTGGG + Intronic
1022489956 7:30809144-30809166 AAGTGGTACTGGAGTGTTATAGG - Intronic
1027647693 7:80824734-80824756 AAGCTGTGCTGCTGTGAAGTGGG - Intronic
1031796848 7:126185934-126185956 AAGTAGCAGGGGAGTGAAGTGGG + Intergenic
1032271561 7:130412835-130412857 AATTTTTATTGGAGTGAAGTTGG - Intronic
1033007674 7:137585227-137585249 AAGTTCTTCTGGAGGCAAGTCGG + Exonic
1033123841 7:138689878-138689900 AAATTATACTTGAGTGGAGTGGG + Intronic
1033204960 7:139411449-139411471 AAATTTTACTGGGGTGGAGTGGG - Intronic
1034167883 7:149039571-149039593 AGGTTGTATTGGAGTAGAGTGGG + Intergenic
1036051940 8:5208677-5208699 AAATTATTCAGGAGTGAAGTAGG + Intergenic
1036643721 8:10599589-10599611 AAGTTGTACTGGGGAGAGGGAGG + Intergenic
1037510875 8:19580903-19580925 AAGTTTTATTGGAGTGAAACAGG + Intronic
1037696052 8:21224890-21224912 ATGTTGTAATGGAGTTTAGTAGG - Intergenic
1038486396 8:27938034-27938056 AAGATGAACTGGAAAGAAGTTGG + Intronic
1039419979 8:37429444-37429466 AAGATGTACTGGGTTGAATTAGG + Intergenic
1039854776 8:41402783-41402805 AAGAGGTACGGGAGTGCAGTTGG - Intergenic
1040716181 8:50255728-50255750 AAGTCATACTGGAGTAAGGTGGG - Intronic
1042055255 8:64757660-64757682 AAGTTGCACCTGAGTGAAGCTGG - Intronic
1042109583 8:65366903-65366925 AGGTTGCTCTGGAGTGAGGTAGG + Intergenic
1042335000 8:67620761-67620783 TAGTTTTATTGGATTGAAGTTGG - Intronic
1043659577 8:82720788-82720810 ATTTTGTACAGGAGTGAAGCTGG - Intergenic
1045875709 8:106978501-106978523 AAGATGGACGGGAGTGAAGGAGG + Intergenic
1046167615 8:110458117-110458139 AAGATGAACTTGAGTGAAATTGG + Intergenic
1046521976 8:115336526-115336548 CAGTTGTAATGGGGTGAAGCTGG + Intergenic
1047857605 8:128928576-128928598 AAGTTTGATTGGTGTGAAGTAGG + Intergenic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1050185035 9:2964320-2964342 AAGTTGTACTGGGGTCTGGTGGG + Intergenic
1051317427 9:15856646-15856668 AAATAGTACTGAAGTGAACTTGG + Intronic
1052033052 9:23650275-23650297 GAGTTGCATTGGAGTGCAGTGGG + Intergenic
1052421559 9:28249550-28249572 AATTTTTTCTGGACTGAAGTAGG + Intronic
1052514112 9:29457742-29457764 AAGATGTACTGAAATAAAGTGGG + Intergenic
1055858350 9:80718900-80718922 AAGTAGTACTGGATTAGAGTGGG - Intergenic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1060980196 9:127787156-127787178 AAGTTGTACTAGAGCTAAGATGG - Intronic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1190270029 X:48855324-48855346 AGGTTGTATTGGAGTGTTGTAGG - Intergenic
1190386167 X:49884049-49884071 AAGCTCTACTGTAGTGATGTGGG - Intergenic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1193955819 X:87860763-87860785 AAGTTGTACTATAATGAAGAGGG + Intergenic
1194587940 X:95759723-95759745 AAGCTGTACAGAAGTGAAGAGGG - Intergenic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1197930994 X:131696236-131696258 AAGTTATACTAGAGTCAGGTTGG + Intergenic
1199754949 X:150855236-150855258 AGGTCATACTGGAGTGGAGTGGG + Intronic
1201308113 Y:12568639-12568661 AAGTGGTACTGGAGTGTTATAGG - Intergenic
1201428246 Y:13878084-13878106 AAGTTTTGCTGGAATGAAGGAGG + Intergenic