ID: 995096653

View in Genome Browser
Species Human (GRCh38)
Location 5:108243640-108243662
Sequence CAGTTTGACAAAACGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995096653_995096655 18 Left 995096653 5:108243640-108243662 CCTTCTTCCGTTTTGTCAAACTG 0: 1
1: 0
2: 0
3: 6
4: 161
Right 995096655 5:108243681-108243703 GATATTTAAATTAACAGATACGG 0: 1
1: 2
2: 6
3: 77
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995096653 Original CRISPR CAGTTTGACAAAACGGAAGA AGG (reversed) Intronic
903249622 1:22043357-22043379 CAGTTAGAGAAAAGGCAAGAAGG + Intergenic
903442114 1:23395895-23395917 CAGTTTGAAACAACAGCAGATGG - Intronic
905352030 1:37354159-37354181 AAGTTAGACAAAAGGGAAAATGG + Intergenic
905440541 1:37993882-37993904 AAGTTTGAAAAAACGGAGGCTGG + Intergenic
906517121 1:46446241-46446263 CAGTTTGAGGGAACGGAAGGAGG - Intergenic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
909110969 1:71476918-71476940 CAAATTGCCAAAACTGAAGATGG + Intronic
911901890 1:103516904-103516926 CATTTTGCCAAAACAGATGAAGG + Intergenic
914453449 1:147813569-147813591 CATTTTGAGAAAAATGAAGAAGG + Intergenic
915186359 1:154108635-154108657 CACCTTCACAAAAAGGAAGAAGG + Intronic
915597954 1:156906059-156906081 CAATTTCACAAAAAGGAACAGGG + Intronic
917771868 1:178288294-178288316 CAGTTTGAGGAAACAGGAGAAGG - Intronic
917846314 1:179023369-179023391 CAGTTTGGGAACAAGGAAGAAGG + Intergenic
920398428 1:205662582-205662604 CAGTTTGACAGAAGGAAAGGCGG - Intronic
920601872 1:207333924-207333946 AAGTGAGACAAAAAGGAAGAGGG + Intronic
924646717 1:245884619-245884641 GTGATTGACAAAAGGGAAGATGG + Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1064795436 10:19006815-19006837 CTCTTAGACAAAAAGGAAGAAGG + Intergenic
1070873318 10:79777652-79777674 ATGTTTGAGAAAACGGAAGGTGG - Intergenic
1071093641 10:81948697-81948719 CACTTTGAGAAAACTGAAGCTGG - Intronic
1071640246 10:87299803-87299825 ATGTTTGAGAAAACGGAAGGTGG - Intergenic
1071654985 10:87438143-87438165 ATGTTTGAGAAAACGGAAGGTGG + Intergenic
1072095824 10:92178479-92178501 AAGGTTGACAGAAAGGAAGAAGG + Intronic
1072286138 10:93917363-93917385 CAGTTTAAAAAAAGGAAAGAGGG - Intronic
1077682396 11:4254887-4254909 CACTTTCAAAAAACTGAAGAGGG - Intergenic
1077912222 11:6582072-6582094 CACCTTCACAAAAAGGAAGATGG + Intronic
1078869708 11:15332092-15332114 CAGTTGGGCAAAACCCAAGAAGG - Intergenic
1081943775 11:46969342-46969364 CAGTTTTATATAACAGAAGATGG + Intronic
1081975665 11:47233089-47233111 CAGTTTGAGAAAGAGAAAGAAGG - Intronic
1082252156 11:49994710-49994732 GTGGTTGACAAAAGGGAAGATGG - Intergenic
1090033361 11:123226738-123226760 AAGTTTGCCACAAAGGAAGATGG - Intergenic
1092152837 12:6262890-6262912 GAGTTTGAAATAAAGGAAGAAGG + Intergenic
1093077338 12:14771448-14771470 CCGTTTGAAAAAACAGAAGGAGG - Intergenic
1093321058 12:17715986-17716008 CACTTTCAGAAAAAGGAAGAAGG - Intergenic
1096019295 12:48308781-48308803 CAGTTGGATAAAACTGAAGAAGG - Intergenic
1097767425 12:63542271-63542293 GTGGTTGACAAAAGGGAAGATGG - Intergenic
1102739958 12:115198350-115198372 AAGATGGACAAAATGGAAGAGGG + Intergenic
1103139201 12:118534134-118534156 GTGGTTGACAAAAGGGAAGATGG - Intergenic
1103817138 12:123667562-123667584 CACTTTCATAAAAAGGAAGATGG - Intergenic
1107345475 13:39455488-39455510 ATTTTTGACAAAATGGAAGATGG - Intronic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1108109039 13:47047519-47047541 CAGTCTGAAAAAAAGAAAGAAGG + Intergenic
1112401023 13:99078421-99078443 CTGTTCCACAGAACGGAAGAGGG + Intronic
1114189143 14:20428029-20428051 CAGTTTGCCCAAAAGAAAGAAGG + Intergenic
1114926077 14:27401145-27401167 CTCTTTGATAGAACGGAAGAGGG - Intergenic
1117976351 14:61300821-61300843 AAGGTTGACAAAAGGGAAGATGG - Intronic
1118975128 14:70670248-70670270 CACTGTGACAAAATGGAATAGGG - Intronic
1121872176 14:97418575-97418597 CAGTTTGCCTAAATGGAGGAGGG - Intergenic
1123202959 14:106684214-106684236 CATATTGACAAAGTGGAAGATGG - Intergenic
1125293520 15:38176177-38176199 CAGATTCACAAAATGGAAAAGGG - Intergenic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1127768636 15:62212133-62212155 CAGTTTTACAAAAAAGAAAAGGG - Intergenic
1128814571 15:70598452-70598474 CAGCTTGGCAGAAGGGAAGAGGG - Intergenic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1133647739 16:7780285-7780307 CAAGTTGACAAAACGAAGGAGGG + Intergenic
1135249798 16:20891467-20891489 TATTTTGACAAATCGGAAGTTGG - Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1137494079 16:48956177-48956199 CAGATTAAAAAAATGGAAGAGGG + Intergenic
1141247843 16:82326998-82327020 CAGCTTGGCAAACTGGAAGATGG - Intergenic
1142789725 17:2254658-2254680 CAGGTTGACACAGCGTAAGAGGG + Intronic
1143214048 17:5210764-5210786 CTTTTTGGCAAAACTGAAGAGGG - Exonic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1149669705 17:58395665-58395687 CAGCTTGACAAAAAGAAAGGTGG + Intronic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1153324366 18:3803125-3803147 CAGGATGACAAAACTGAATATGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156526846 18:37775776-37775798 CAGTCTGAGCAACCGGAAGACGG + Intergenic
1158430020 18:57376815-57376837 CAGTTTCAGAAACAGGAAGATGG + Intergenic
1160253432 18:77224814-77224836 CAGTTTAATAAAATGGAATACGG - Intergenic
1161217356 19:3101095-3101117 CAGTTTGACAGAAGAGAAAACGG - Intronic
1163798181 19:19349087-19349109 CAGGTTTACAAAACGGCAGTGGG - Intronic
1165138313 19:33684665-33684687 TAGTCTGACAAAACAGAAGGAGG + Exonic
926586976 2:14697219-14697241 CAGTTTGAAGAATTGGAAGAAGG + Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
932015915 2:68026159-68026181 CAGATTGACACAACTGATGAGGG - Intergenic
934925150 2:98377039-98377061 GAGTTTGGCAAAAGGGACGAGGG + Intronic
935407649 2:102725867-102725889 CAGTTTAACAAAACTCGAGATGG + Intronic
936744404 2:115557394-115557416 CATTTTGACACCACGTAAGATGG + Intronic
940196189 2:151096952-151096974 AAGTTTGCTAAAACGGAGGATGG - Intergenic
940804830 2:158175135-158175157 GGGTTTGACCAAGCGGAAGAGGG - Intronic
941595938 2:167477205-167477227 CTTTTGGACAAAAGGGAAGAAGG + Intergenic
944396757 2:199276749-199276771 CATTTTGAAAAAAGGGAAAAAGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
945940053 2:215940193-215940215 TAGTGTGTCAAAACAGAAGATGG + Intergenic
946883685 2:224201770-224201792 CAGCTTGACAGAACAGAAGTGGG + Intergenic
947264931 2:228267940-228267962 CTGTTGGACAAAAGGAAAGAAGG + Intergenic
1172956466 20:38763150-38763172 CAGTGTGACATAACAGAAGGTGG - Intronic
1177602312 21:23331690-23331712 GAGTTTGATTACACGGAAGAAGG - Intergenic
1179272976 21:39865848-39865870 CAGATTGACAGATTGGAAGAAGG - Intergenic
1179340965 21:40508947-40508969 CATTTTGACAAAAGGAATGATGG + Intronic
1183733161 22:39629497-39629519 CATTGTGATAAACCGGAAGATGG - Intronic
949365947 3:3280577-3280599 CAGTTTGACAGAGCGGAAGTTGG + Intergenic
951106149 3:18745626-18745648 CAGTCTGGCTGAACGGAAGAAGG - Intergenic
954556339 3:51520344-51520366 CAGTTTTACAGAGGGGAAGATGG + Intergenic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
959500518 3:107101632-107101654 GTGGTTGACAAAAGGGAAGATGG - Intergenic
967301380 3:188017589-188017611 CAGTTTTGCAAAAAGGAAAATGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969974943 4:11088887-11088909 CAATTTGACAACACTGAAAATGG + Intergenic
970907615 4:21235400-21235422 ATGTTTGACAAAAGGGAAGAAGG - Intronic
978357422 4:107891845-107891867 CATGGTGACAAAAAGGAAGATGG + Intronic
979752960 4:124302327-124302349 CATTTTGGGAAAATGGAAGAAGG - Intergenic
981880683 4:149607829-149607851 CACTTTTACACAAAGGAAGATGG + Intergenic
984789877 4:183605662-183605684 CAAATTGTCAAAACTGAAGACGG - Intergenic
985204081 4:187514793-187514815 CAGATGGTCAAAATGGAAGAAGG - Intergenic
987923496 5:24312613-24312635 CACTTTGACAAAACAGAAACTGG + Intergenic
992770135 5:80039929-80039951 GAGTTTGGCAATACGGAAAAGGG + Intronic
993771012 5:91926270-91926292 CATTTTGTCACAAGGGAAGATGG - Intergenic
993968326 5:94386052-94386074 CAGTTTGACAAATAGAAAAAAGG + Intronic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
995736705 5:115308598-115308620 CAGTTGCAGAAAACAGAAGAGGG - Intergenic
996096385 5:119403380-119403402 CCATTTGACAAAGCGGATGAAGG - Intergenic
997014577 5:129917825-129917847 GATTTTGACATAACGGATGAAGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
998245366 5:140497467-140497489 CAATATGACAAAAAAGAAGAGGG - Intronic
999851302 5:155542152-155542174 CAGATTGACAGATCGCAAGAAGG + Intergenic
1000231849 5:159323089-159323111 CTGCTTCACAAAAAGGAAGATGG - Exonic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001753776 5:174150776-174150798 GGGCTTGACAAAAGGGAAGAGGG + Intronic
1004456742 6:15798448-15798470 CAGTTTGTCAGAAGGGCAGATGG + Intergenic
1007987775 6:46224474-46224496 CAGTTTGACCAAAACAAAGAAGG - Intronic
1008818334 6:55597749-55597771 CAGTTTGTAAAAATGGAAAATGG + Intergenic
1011920065 6:92563113-92563135 AAGTTTAACCAAACGGAAGTGGG - Intergenic
1013496945 6:110706931-110706953 CAATTTGGCAAAGTGGAAGATGG + Intronic
1015744817 6:136498644-136498666 GAGTTTGGAAAAATGGAAGATGG + Intronic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016053356 6:139553249-139553271 CAGCTTGAGAAAAGGAAAGAGGG + Intergenic
1017794088 6:157825268-157825290 CCGTTTGAAAAAAGAGAAGACGG + Intronic
1020391271 7:7661310-7661332 GAGTTTGACAAATTGAAAGAAGG - Intronic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1022037132 7:26545140-26545162 CAGGGTGACAAAATGGAACACGG + Intergenic
1022072425 7:26930255-26930277 CAGTTTGAAAAAGGAGAAGATGG - Intronic
1024719334 7:52117690-52117712 CAGTTTTACAAAAAGAAAAAAGG + Intergenic
1026584275 7:71643502-71643524 CATTTTTACAAAAGGGAAAAAGG + Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1028087758 7:86657367-86657389 CTGTTTGACATAACTGTAGAAGG + Intronic
1028095155 7:86751284-86751306 CAGTGTGACACATCTGAAGAGGG - Intronic
1028780550 7:94730522-94730544 CACTTTCACAAAAAGGAAGAGGG + Intergenic
1030258072 7:107533315-107533337 CAGTTTGACAAATTGACAGAAGG + Intronic
1031127485 7:117791407-117791429 CAGTTTGCCACAAGGGAACAGGG - Exonic
1031490216 7:122378264-122378286 CAGTATGACAAAATAGAAAAAGG + Intronic
1031667246 7:124499701-124499723 AAGTTTGACAGAAGGGAAGTGGG + Intergenic
1035326573 7:158070038-158070060 GAGGTTGGCAAAATGGAAGAAGG - Intronic
1041892690 8:62888917-62888939 CAGTTCAACAAAAGGTAAGAAGG - Intronic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042358304 8:67853931-67853953 AAGTTTGACATAAGGGAATATGG + Intergenic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1043403454 8:79906518-79906540 AAGTTTGAGGAAACTGAAGAGGG - Intergenic
1043487971 8:80717557-80717579 CAGATTGGCAAAGAGGAAGAGGG - Intronic
1044624551 8:94224074-94224096 CATTTTGACAGAAAAGAAGAAGG + Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1047341020 8:123980716-123980738 AAGGCTGACAAAACTGAAGATGG + Exonic
1047691053 8:127355076-127355098 CAGTTTGGCAGAACAGAACAGGG - Intergenic
1048260888 8:132944160-132944182 CAGCTTCACAGAAGGGAAGAGGG - Intronic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1059119895 9:111631956-111631978 CAATGTCACAAAAAGGAAGAGGG - Intronic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1060127012 9:121057677-121057699 CACTTTTACACAAAGGAAGATGG + Intergenic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1189228381 X:39432708-39432730 CAGATTCACAGAACAGAAGAGGG + Intergenic
1190571622 X:51788439-51788461 GAGTTTGTCAAAAAGTAAGAAGG + Intergenic
1190978838 X:55436230-55436252 CACTTTCGCAAAAAGGAAGACGG + Intergenic
1196996796 X:121392521-121392543 CAGTTTGAAGAAACAGCAGACGG + Intergenic
1198425151 X:136511033-136511055 AAGTTTGAAAAGACAGAAGATGG + Exonic
1199194478 X:145011251-145011273 CAGTTTGACAAGATGGACGTTGG + Intergenic
1201012290 Y:9559471-9559493 CAGATTGACAAAAGAGAACAAGG - Intergenic