ID: 995097764

View in Genome Browser
Species Human (GRCh38)
Location 5:108259544-108259566
Sequence CATTTCTAACTGAGGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995097764_995097770 6 Left 995097764 5:108259544-108259566 CCACACAGCCTCAGTTAGAAATG 0: 1
1: 0
2: 2
3: 23
4: 290
Right 995097770 5:108259573-108259595 ACTAATGGGGCTTTGTGAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 186
995097764_995097766 -9 Left 995097764 5:108259544-108259566 CCACACAGCCTCAGTTAGAAATG 0: 1
1: 0
2: 2
3: 23
4: 290
Right 995097766 5:108259558-108259580 TTAGAAATGAATATGACTAATGG No data
995097764_995097767 -8 Left 995097764 5:108259544-108259566 CCACACAGCCTCAGTTAGAAATG 0: 1
1: 0
2: 2
3: 23
4: 290
Right 995097767 5:108259559-108259581 TAGAAATGAATATGACTAATGGG 0: 1
1: 0
2: 0
3: 33
4: 326
995097764_995097769 5 Left 995097764 5:108259544-108259566 CCACACAGCCTCAGTTAGAAATG 0: 1
1: 0
2: 2
3: 23
4: 290
Right 995097769 5:108259572-108259594 GACTAATGGGGCTTTGTGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 116
995097764_995097768 -7 Left 995097764 5:108259544-108259566 CCACACAGCCTCAGTTAGAAATG 0: 1
1: 0
2: 2
3: 23
4: 290
Right 995097768 5:108259560-108259582 AGAAATGAATATGACTAATGGGG 0: 1
1: 0
2: 0
3: 27
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995097764 Original CRISPR CATTTCTAACTGAGGCTGTG TGG (reversed) Intronic
900887061 1:5422743-5422765 CGTTTCCTTCTGAGGCTGTGAGG - Intergenic
901305805 1:8232002-8232024 CATTCCTTAGTGATGCTGTGAGG - Intergenic
902930830 1:19730330-19730352 CATTTCTCACTCATGCTGTCTGG - Intronic
904790740 1:33018746-33018768 GATTTCTAACTGAGGTTGGGTGG - Intronic
904893942 1:33800139-33800161 CATTGTAAACTGAGGCTGGGTGG - Intronic
905061029 1:35139168-35139190 CAGTTTTAACTCAGACTGTGGGG - Intergenic
905431252 1:37925684-37925706 CACTTCTAACTGAGTGTTTGTGG + Intronic
907307072 1:53519350-53519372 CTTTTCTTCCTGAGGCTGTTTGG + Intronic
911034842 1:93531395-93531417 CTTTTTTACCTGAGGCTGTTTGG - Intronic
911236912 1:95421852-95421874 CATGTCTTACTGTGGCTGTGTGG + Intergenic
911470713 1:98314801-98314823 CATGGCCAACTGTGGCTGTGTGG + Intergenic
913417924 1:118632616-118632638 CATTTCTAACTGAGCTTATTTGG + Intergenic
914682006 1:149945020-149945042 CATCTCCAGCTGAGGCGGTGGGG + Exonic
915981968 1:160425928-160425950 GATTTCTAACTCGGGCTGTGTGG - Exonic
918366792 1:183816471-183816493 CATTCCTGGCTGAGGCAGTGGGG - Intronic
920512670 1:206562488-206562510 CATCTCTAAATGAGGCTATCTGG - Intronic
920712773 1:208310766-208310788 CAGTTTTCACTGGGGCTGTGGGG + Intergenic
920719113 1:208370304-208370326 CAGAAATAACTGAGGCTGTGAGG + Intergenic
1064273568 10:13886453-13886475 CATTACTAACTGAGGAAGAGGGG + Intronic
1064282237 10:13961343-13961365 AATTTCCATCTGAGGCTGGGCGG + Intronic
1067233966 10:44431965-44431987 CATTTCTAATTGAGGTTATTTGG + Intergenic
1068011126 10:51453148-51453170 CATTTCTAACTGAGCTTATTTGG + Intronic
1069006590 10:63324159-63324181 TATTTCTGACTGTGTCTGTGAGG - Intronic
1069079464 10:64072684-64072706 CATTTCTAATTCAAGCTCTGTGG - Intergenic
1071881919 10:89908605-89908627 CATTTCTAACTGTGTCTATTTGG + Intergenic
1071957285 10:90772600-90772622 CATTTCTAAGTGTGTGTGTGTGG + Intronic
1072972322 10:100028070-100028092 CATTTCAAACTGAGACTTAGTGG + Intergenic
1074129819 10:110564067-110564089 TTTTTCTCACTGATGCTGTGAGG - Intergenic
1075193691 10:120335403-120335425 CATTTATAACTGAGGCTATCTGG - Intergenic
1075339009 10:121630503-121630525 TATTTGTAACAGAGACTGTGTGG - Intergenic
1075889421 10:125933488-125933510 CATTTCTTAATGAGGTTGTCTGG + Intronic
1077977825 11:7266516-7266538 CCTCTCTAACTGAACCTGTGGGG - Intronic
1078773794 11:14375404-14375426 GATTGCTCACTGAGGCTGTGGGG - Intergenic
1078923978 11:15857762-15857784 CATTTCATAAGGAGGCTGTGGGG + Intergenic
1079478203 11:20853882-20853904 AATTTGTAACTGAGGCAGAGTGG + Intronic
1079791407 11:24744566-24744588 CATTTCTTAGTGAGGTTGTTTGG + Intronic
1080898792 11:36467860-36467882 ATGTTCCAACTGAGGCTGTGTGG + Intergenic
1081307358 11:41529847-41529869 CATTTATAACTGAGTTGGTGGGG + Intergenic
1082257629 11:50049996-50050018 CATTTATAAGTGAGAATGTGTGG + Intergenic
1082996317 11:59258351-59258373 AACTGCTCACTGAGGCTGTGTGG - Intergenic
1085193874 11:74654144-74654166 CATTTCAACATGAGGCTTTGAGG + Intronic
1086753941 11:90534568-90534590 CATTTCTAGCTCAGCCTGAGAGG + Intergenic
1087564340 11:99835314-99835336 GATTTTTAACTGTGGTTGTGAGG + Intronic
1088545350 11:110953479-110953501 CATTTCAGACTCAGGCTCTGTGG - Intergenic
1088591658 11:111408611-111408633 CATTTCTACCTGAAGGTGAGAGG + Intronic
1088743980 11:112789247-112789269 CATTTCTACCTGCTGCTGTGTGG - Intergenic
1088772734 11:113052106-113052128 CATTTGGAACTGAATCTGTGTGG + Intronic
1091104089 11:132902204-132902226 CATTGCAAACTGAGGCTGAATGG + Intronic
1092816950 12:12320695-12320717 CATTTAAAAAGGAGGCTGTGTGG + Intergenic
1092937391 12:13376800-13376822 TATTTCTAGGTGTGGCTGTGAGG - Intronic
1093176619 12:15919950-15919972 CATTTCTTTCTCAGGCTGTGGGG - Intronic
1093415663 12:18917682-18917704 CATTTCTAGGTGTGTCTGTGAGG + Intergenic
1097782013 12:63717891-63717913 AATTTCAAACTGAAACTGTGAGG + Intergenic
1100038215 12:90279557-90279579 CAGTGCTGACTGAGGCTCTGTGG + Intergenic
1101414736 12:104499326-104499348 CAGTTCTAACTGAGCTTCTGGGG - Intronic
1101940303 12:109094887-109094909 CATTTCTCATAGAGGCTGAGAGG - Intergenic
1102187348 12:110959253-110959275 CATTTCTAACAGAGCATGTATGG + Intergenic
1103854700 12:123958498-123958520 AATTTCAAACTCAGGCTGTTTGG + Intronic
1104079637 12:125418747-125418769 CCTTTCTAACTGAGCATGTCGGG - Intronic
1105316335 13:19268109-19268131 GCTTTCTTGCTGAGGCTGTGGGG - Intergenic
1105912113 13:24878792-24878814 CATTTCTAGGTGTGTCTGTGAGG - Intronic
1108028690 13:46205817-46205839 CATCTCTGACTATGGCTGTGTGG + Intronic
1108469201 13:50751789-50751811 CGTTTCTTACTGAGGTTATGTGG + Intronic
1111823714 13:93243633-93243655 GATTTCTAAATAAGGCTGTTTGG + Intronic
1113804467 13:113105324-113105346 CACTTCTCAGTGAGGCTCTGTGG + Intergenic
1114951082 14:27754387-27754409 AATTTCTAACTGTGAATGTGGGG + Intergenic
1115000192 14:28412572-28412594 CAATGTTAACTGAAGCTGTGGGG + Intergenic
1115509612 14:34126724-34126746 CATTTCTATCAGGGGTTGTGAGG - Intronic
1115885246 14:37964122-37964144 CATTTATAAGTGAGAATGTGTGG + Intronic
1119191385 14:72684707-72684729 CTTTACTAACTTAGGCTGTTTGG - Intronic
1119198230 14:72733195-72733217 CATATCAAACTGTGGCAGTGTGG - Intronic
1121015084 14:90544171-90544193 CATCTCTACCTGAGGCAGCGTGG - Intronic
1122768781 14:104087845-104087867 CATTTCTGAAAGAGGCTGTGAGG + Intronic
1122773432 14:104107045-104107067 CAGGTCTCACTGAGGCTTTGAGG + Intronic
1126262437 15:46709896-46709918 CATCTATATCTGATGCTGTGAGG + Intergenic
1126977548 15:54200951-54200973 CGTTTCTAACTGAGCCTATTTGG - Intronic
1127909453 15:63404349-63404371 CATTTCTGAATGAGGCTGCATGG + Intergenic
1128437120 15:67664137-67664159 CATTTCTGTGTGAGGCTTTGTGG - Intronic
1129120872 15:73395764-73395786 CATTAGGAACTGAAGCTGTGAGG - Intergenic
1131520174 15:93108593-93108615 CATTTATAACTGAGAACGTGTGG - Intergenic
1132456423 16:26192-26214 TATTTATAACAGGGGCTGTGTGG - Intergenic
1134910665 16:18023389-18023411 CATGACCAACTGAGGCTGGGCGG - Intergenic
1135917614 16:26619864-26619886 CATTTCTAATTGAGCCTATTTGG + Intergenic
1136000768 16:27291122-27291144 GCTTTCTAACTGGGGCTCTGCGG - Intergenic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1138757036 16:59500278-59500300 CATTTTAAACAGAGGCTGTCAGG - Intergenic
1139063296 16:63281948-63281970 CATTTCTGGCTGTGTCTGTGAGG - Intergenic
1141257220 16:82414027-82414049 CATCTCCACCGGAGGCTGTGAGG - Intergenic
1142104006 16:88292293-88292315 CATTTCCAACTGGGGCAGGGTGG + Intergenic
1144276664 17:13675919-13675941 CATTTCTAATTGAGGTTTTTTGG - Intergenic
1145734158 17:27214699-27214721 CATTTCTATCTGATTCTGTTTGG + Intergenic
1146831451 17:36072869-36072891 CATTTCTGAGTGTGTCTGTGTGG + Intergenic
1149513131 17:57258692-57258714 CGTTACCAACTGTGGCTGTGGGG + Intronic
1149516263 17:57283288-57283310 CATTACTGACTGACCCTGTGCGG - Intronic
1151283772 17:73095321-73095343 CCTTTCTCACTGCTGCTGTGAGG + Intergenic
1154316685 18:13309844-13309866 CTTTTGTGACTGAAGCTGTGTGG + Intronic
1155849688 18:30756055-30756077 AATTTCTAACTTATGCTATGAGG + Intergenic
1156657349 18:39304771-39304793 TATTTCTAGCTGTGTCTGTGAGG + Intergenic
1156784667 18:40895820-40895842 CATTTATAAGTGAGAATGTGTGG + Intergenic
1158017267 18:52798612-52798634 TATTTATAACTGTGTCTGTGAGG + Intronic
1158556168 18:58476331-58476353 GATTTCTATCTGGGACTGTGTGG + Intergenic
1158887471 18:61841883-61841905 CAGTTGTAACAGATGCTGTGTGG - Intronic
1160267350 18:77351103-77351125 CATTTCTTAATGAGGCTCTTTGG + Intergenic
1160794728 19:939986-940008 CATTTCAGACTGAGGCTTAGGGG + Intronic
1162021029 19:7868742-7868764 TATTGCAAACTCAGGCTGTGCGG + Exonic
1162256040 19:9490569-9490591 TATTTGTAACAGAGACTGTGTGG - Intronic
1162606432 19:11711785-11711807 CATTTCTAAGTGAGAATATGTGG + Intergenic
1168584120 19:57578836-57578858 CGTTTCTAACTCAGGCGGCGTGG + Exonic
926385559 2:12332664-12332686 CCTTTCTTGCTGAGGTTGTGGGG + Intergenic
926842086 2:17092223-17092245 CATTTCTGACTGTGTTTGTGAGG + Intergenic
927445414 2:23156726-23156748 CATTTCTAACTGCGCATCTGAGG - Intergenic
927829855 2:26340219-26340241 CATGTATAACTAAGGCTATGTGG - Intronic
928334952 2:30390062-30390084 CTTTTCAACCTGGGGCTGTGAGG - Intergenic
928356962 2:30625368-30625390 CATTTCTAACTGAGCTTATTTGG - Intronic
928788253 2:34917047-34917069 CCTTTCTAACTCATTCTGTGAGG + Intergenic
929037070 2:37704067-37704089 CATTTCTAATTGAGCTTGTGTGG + Intronic
929377361 2:41304536-41304558 CATTTTTAACAGAGGTTGTAGGG + Intergenic
930373889 2:50539952-50539974 CATATCTAACTAAGGATGTAAGG + Intronic
930954400 2:57187672-57187694 CATTTATAAGTGAGAATGTGTGG - Intergenic
932384608 2:71320279-71320301 CATTTCTAACTGAGCTTATTTGG + Intronic
932846896 2:75144449-75144471 CATTTCTCTATGAGGCTGTGGGG - Intronic
933083821 2:78029346-78029368 TATTTCTAACTGATTCTATGAGG + Intergenic
934853815 2:97717038-97717060 CATGGCTAACTGCGGCTGTGTGG + Intronic
935423643 2:102896739-102896761 CACTACACACTGAGGCTGTGTGG - Intergenic
935572416 2:104675988-104676010 CAGATCTAACTGTGTCTGTGGGG - Intergenic
937102332 2:119281350-119281372 CACTTATAACTGAGGATATGTGG + Intergenic
937824505 2:126352768-126352790 CATTTGTAAGTGAGGATGTGTGG - Intergenic
937961082 2:127459440-127459462 CATTTCTAACTCATTCTGTGAGG + Intronic
938637399 2:133243711-133243733 TACTTCTAACTAAGGCTGCGAGG + Intronic
939250081 2:139671648-139671670 CATTACCAACTGATGCTGTCAGG + Intergenic
940651254 2:156443175-156443197 CATTTCTGACTGGGGCTGTGAGG - Intronic
943642297 2:190372976-190372998 CATGTGTAAGTGAGGCCGTGTGG + Intergenic
943911190 2:193570145-193570167 CCTTTCTAACTCATTCTGTGAGG - Intergenic
945309255 2:208291480-208291502 ACTTTCTAACTCAGTCTGTGAGG - Intronic
946806409 2:223475151-223475173 TATTGCAAACTGAGGGTGTGAGG + Intergenic
948122741 2:235543280-235543302 CATTTCTCACTGATGCTGCCTGG - Intronic
948487428 2:238289641-238289663 CCTTTCTCACGGAGCCTGTGGGG - Intronic
948570808 2:238915967-238915989 CATTTATAACGGAAGCTGAGAGG - Intergenic
948726994 2:239940150-239940172 TATTTGTAACAGAGGCTGTATGG - Intronic
1169739720 20:8879035-8879057 CACTTATAAGTGAGACTGTGTGG + Intronic
1169984916 20:11433574-11433596 TATTTCTAAGTGTGTCTGTGAGG + Intergenic
1170095721 20:12643808-12643830 AATTTATAGCTGAGGCAGTGAGG + Intergenic
1170865633 20:20153502-20153524 CATTTCTAATTGAGGCTATTTGG - Intronic
1171164092 20:22955526-22955548 CCTTTCTAACTGGGGCTTGGAGG + Intergenic
1171309578 20:24135470-24135492 CATTACCAAGTGAGGCAGTGAGG - Intergenic
1172949641 20:38714617-38714639 CACTTCCATCTGAGGCTGTGGGG + Intergenic
1173472456 20:43334357-43334379 CATTTCAAACAGGGGCTTTGGGG + Intergenic
1173598220 20:44273792-44273814 CAGTTCTGAGTGAGGATGTGGGG - Intronic
1173791501 20:45830820-45830842 CATTTCTCAGGGAGGCTGTAGGG + Intronic
1174681354 20:52411860-52411882 TATTTGTAACAGAGACTGTGTGG + Intergenic
1177749918 21:25268349-25268371 CATTTCTAAGTGAGCTTGTTTGG - Intergenic
1181370703 22:22414183-22414205 CATTTCTAATTGAGCTTATGTGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951528830 3:23679910-23679932 CATTTCAAACCGAGGCCGAGGGG + Intergenic
953195916 3:40732759-40732781 CATTTCTAATTGAGGTTTTTGGG + Intergenic
953849210 3:46453321-46453343 TACTTCTAACTGAAGTTGTGGGG + Intronic
954390713 3:50266784-50266806 CATTCCCAACTGAGGCTCCGAGG + Intergenic
956334376 3:68146730-68146752 AATTTATAACTGAGGTTGAGAGG + Intronic
956871366 3:73421368-73421390 CTTTTACAACTGAGGCTCTGAGG + Intronic
957921483 3:86754153-86754175 CATTTCTAATTGAGCTTGTTTGG + Intergenic
958016394 3:87943840-87943862 CATTTCTTTCTTAGCCTGTGAGG + Intergenic
958444634 3:94200109-94200131 CATTTCTAACTGAGCTTATTTGG + Intergenic
958768624 3:98400396-98400418 CATTTCTAACTGAGTTTATTTGG - Intergenic
962861921 3:139411565-139411587 CATTTCTAATTGAGTTTGTTTGG + Intergenic
962879648 3:139564269-139564291 CATTTCTGAGTGTGTCTGTGAGG - Intronic
963325724 3:143860917-143860939 CATTTCTAATTGAGCTTGTTTGG + Intergenic
963429880 3:145186602-145186624 AATTTTTAATTGTGGCTGTGTGG + Intergenic
966763731 3:183439812-183439834 CATTTATAAGTGAGGATATGTGG - Intergenic
967210351 3:187162779-187162801 CATATTTAGCTGAGGCTGAGAGG + Intronic
967252762 3:187559930-187559952 CATTTGTAACTCAGTGTGTGAGG - Intergenic
967475069 3:189907075-189907097 CATTTCTGATTGTGTCTGTGAGG - Intergenic
967958436 3:194898031-194898053 CATTTCTAACTGAGCTTATTTGG + Intergenic
968821017 4:2851323-2851345 CATATCTAACTGGAGGTGTGAGG + Intronic
969427384 4:7133266-7133288 CCTGTCTGACTCAGGCTGTGGGG + Intergenic
971039069 4:22730840-22730862 TATTTCTAAGTGTGTCTGTGAGG + Intergenic
971602650 4:28614853-28614875 CATTTATAAGTGAGAATGTGTGG + Intergenic
971662392 4:29436363-29436385 AAATTGTAACTGAGGCTGTGGGG - Intergenic
971866975 4:32184906-32184928 CATTCCTAACAAAGGTTGTGAGG + Intergenic
972016158 4:34248749-34248771 CATTCTTAAATGAGGCTATGTGG + Intergenic
972382491 4:38532260-38532282 CAGTTGTAACTGAGGCTGCTGGG - Intergenic
972728880 4:41773417-41773439 CAACTCTAATTGGGGCTGTGTGG + Intergenic
973121757 4:46529764-46529786 CATTTATAAGTGAGAATGTGTGG + Intergenic
977828986 4:101567771-101567793 CATTTCTAATTGAGCCTATTTGG - Intronic
978024313 4:103852931-103852953 CATTTCTAACTGTGTTTGTTTGG - Intergenic
978928257 4:114277393-114277415 CACTTATAAGTGAGGATGTGTGG + Intergenic
979454756 4:120914917-120914939 CATTTGTAAGTGAGAATGTGTGG - Intronic
981089374 4:140716677-140716699 AGTTTCTAACTGAGGATGTAAGG - Intronic
981664237 4:147203789-147203811 AATTTATAAATGAGGCTGTTTGG + Intergenic
981736165 4:147953278-147953300 AATTTCTAACTCATTCTGTGAGG - Intronic
982845196 4:160243836-160243858 CATTTCTAATTGAGTTTGTTTGG + Intergenic
983120530 4:163878482-163878504 CTTTTCTAACTCAGGATTTGGGG + Intronic
983538158 4:168879630-168879652 CATTGCTAACTGAAGCTGCCTGG - Intronic
987302548 5:16609512-16609534 AAATTCTATCTCAGGCTGTGAGG + Intronic
987563839 5:19559049-19559071 CATTTCTAATTGAGCTTGTTTGG + Intronic
987816254 5:22904549-22904571 CACTTCTAAGTGAGAATGTGTGG - Intergenic
987901833 5:24022972-24022994 CATTTCTGACTGTGGCTCAGAGG + Intronic
988034964 5:25815613-25815635 CATTTCTAGGTGTGTCTGTGAGG - Intergenic
988789538 5:34594588-34594610 CATTTCTAGATGTGTCTGTGAGG - Intergenic
988889810 5:35602812-35602834 CATTTCTAATTGAGCTTGTTTGG - Intergenic
988966907 5:36428395-36428417 CCTTTCTAACTCATTCTGTGAGG - Intergenic
989844829 5:46129034-46129056 CATTTCCAACTGAGGTACTGAGG + Intergenic
990365594 5:55067021-55067043 CTGTACTAACAGAGGCTGTGGGG - Intergenic
990868785 5:60408428-60408450 CATTGCCAACTGAGGCTCTGAGG + Intronic
991550055 5:67825956-67825978 CATTTCTGACTCAGGCTAGGGGG + Intergenic
992335784 5:75767684-75767706 CATTTCTAATTGAAGTTGTTTGG + Intergenic
993447011 5:88025633-88025655 CAGTTGTAACAGAGGCTGTATGG - Intergenic
994207704 5:97054035-97054057 CTTTTCTAACTGAGCTTGTTTGG + Intergenic
995097764 5:108259544-108259566 CATTTCTAACTGAGGCTGTGTGG - Intronic
996318555 5:122188635-122188657 CGTTTCTTTCTGAGGCTCTGAGG - Intergenic
996570624 5:124929363-124929385 CAGTGCTGGCTGAGGCTGTGTGG + Intergenic
997625100 5:135326310-135326332 GATTTCCGACTGATGCTGTGTGG + Intronic
997715403 5:136038863-136038885 CATTCCTCACAGAGGCTGTAGGG - Intronic
998093151 5:139382549-139382571 CATGTCAAACTTAGGCTCTGTGG + Exonic
999450874 5:151677158-151677180 TATTCCTAACAGAGGCTCTGTGG + Intronic
999839188 5:155406143-155406165 CATTTCTAACTGAGCTTATTTGG - Intergenic
1000402623 5:160847465-160847487 CAGTTCTAACTGAGGTTTGGGGG - Intronic
1003744791 6:8988344-8988366 CATTTCTGAGTGTGTCTGTGAGG + Intergenic
1005809560 6:29505723-29505745 CTTTTCTCACCCAGGCTGTGGGG - Intergenic
1007060432 6:38935236-38935258 CATTTCTTACAGAAGCAGTGTGG + Intronic
1007311684 6:40951574-40951596 CATTTCTGACAGTGGTTGTGAGG + Intergenic
1009267326 6:61572102-61572124 CATTTCTAACTGAGCTTATTTGG - Intergenic
1009301467 6:62028177-62028199 CATTTCTGACTGCAGATGTGTGG - Intronic
1009923138 6:70087934-70087956 AATTTCAAACTGAGGATTTGGGG + Intronic
1010065037 6:71672652-71672674 CATTTCTGACTGAGACTTAGAGG + Intergenic
1011283527 6:85700789-85700811 CATTTCCAACTGAGGTACTGGGG - Intergenic
1011366725 6:86590523-86590545 CATTTCTAAGTGTCTCTGTGAGG + Intergenic
1011833975 6:91407328-91407350 CATTTCTAACTGAGCTTATTTGG - Intergenic
1012850669 6:104443029-104443051 CATTTATTACTGAGGTTGAGAGG + Intergenic
1013851407 6:114520368-114520390 TATTTCTAGGTGAGTCTGTGAGG - Intergenic
1015294911 6:131579557-131579579 CATTTCTAAATAAGTATGTGAGG + Intronic
1016197185 6:141358665-141358687 CATTTCTTAGTGAGGCTATTTGG + Intergenic
1016768884 6:147826713-147826735 CATTTATAACTAAGGCCATGTGG + Intergenic
1016865603 6:148762767-148762789 CACTTCTAAGTGAGAATGTGTGG + Intronic
1017227266 6:152036634-152036656 CATTTCTAAATGCATCTGTGAGG - Intronic
1018409396 6:163527223-163527245 CTTTTATAACTGAGTCAGTGAGG + Intronic
1021204567 7:17764674-17764696 CATTTCTTAGTGAGGTTATGTGG - Intergenic
1021537612 7:21723091-21723113 CATTTAAAACAGAGGCTATGAGG + Intronic
1021966073 7:25920423-25920445 CATTTTTAAATGAGGTTGTTGGG - Intergenic
1022940613 7:35233992-35234014 AATTTCAAACTGAAACTGTGAGG + Intronic
1023882039 7:44326115-44326137 CATCTCTTCCTGAGGGTGTGAGG - Intronic
1024165717 7:46727818-46727840 CATTTCTAACTGTGCTTATGCGG - Intronic
1025794531 7:64726527-64726549 CATTTCTAATTGAGGTTCTTTGG + Intergenic
1028720818 7:94028781-94028803 CATTTCTGACTTAGTATGTGTGG + Intergenic
1028801642 7:94972382-94972404 CATTCCTAACTTATGCTGTTAGG + Intronic
1029021525 7:97369753-97369775 CATTTCCAAGTGTGTCTGTGAGG - Intergenic
1030317849 7:108134635-108134657 CATTCCTAAGTGTGCCTGTGTGG + Intergenic
1030669923 7:112325041-112325063 CATTTCTAGGTGTGTCTGTGAGG - Intronic
1030938728 7:115618244-115618266 CATTTCAATATGAGACTGTGTGG + Intergenic
1031698993 7:124900610-124900632 CATTTCCAACTGAGGTACTGGGG + Intronic
1032555493 7:132829159-132829181 CATTTCTAACTGAGACTACTAGG - Intronic
1033163414 7:139017172-139017194 GATTTCAAAGTGAGGCTGTTTGG - Intergenic
1033532237 7:142276242-142276264 CATTTCTAATTGTGTCTGTTTGG - Intergenic
1034783787 7:153906426-153906448 CAGTTATAAGTGAGGATGTGTGG + Intronic
1039073852 8:33670993-33671015 TATTTCTTATGGAGGCTGTGGGG - Intergenic
1039268638 8:35855892-35855914 CATTTCTTACTGAGGTTATTTGG - Intergenic
1039458809 8:37726757-37726779 CATCTCTAGCTGTGGCAGTGGGG - Intergenic
1040088218 8:43367180-43367202 CATATCTAACTGAGGTTCTCTGG - Intergenic
1040362449 8:46679948-46679970 CATTTCTAACTGAGCTTATTTGG + Intergenic
1040583919 8:48722114-48722136 CATTTCTAAATCAGGTTTTGGGG - Intronic
1041189575 8:55340260-55340282 CATTTTTAGCTGAGGTTGTGTGG + Intronic
1041470446 8:58202938-58202960 CATTTCTGAGTGTGCCTGTGAGG + Intronic
1042608239 8:70568581-70568603 CATTTCTAATTGAGCCTATTTGG - Intergenic
1042775795 8:72429473-72429495 CAGTTCCTTCTGAGGCTGTGAGG - Intergenic
1042793939 8:72639453-72639475 CTTTTCTACCTCTGGCTGTGAGG + Intronic
1043545363 8:81309413-81309435 CATTTCTAACTGAGCTTATTTGG - Intergenic
1043918670 8:85955174-85955196 CATTTAAAAGTGAGGATGTGTGG - Intergenic
1044726421 8:95197934-95197956 CAATGATTACTGAGGCTGTGGGG - Intergenic
1046363296 8:113190229-113190251 CTTTTCTCACAGAGCCTGTGAGG + Intronic
1046863005 8:119116038-119116060 CATTTGTAACTGAGAATTTGTGG - Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1047299801 8:123603789-123603811 CATTTATAAGTGAGGATATGTGG - Intergenic
1048757162 8:137752588-137752610 TATTTCTAGCTGTGTCTGTGAGG + Intergenic
1048985865 8:139734524-139734546 CATTTCTAAGAGAGGCTGATAGG + Intronic
1050157221 9:2680183-2680205 CAATTATCACTGGGGCTGTGTGG - Intergenic
1050566978 9:6895278-6895300 CATTTCTTACTGAGACTCTGGGG + Intronic
1051805120 9:20983679-20983701 GATTTCAAACTGAAGCAGTGAGG - Intronic
1054929444 9:70620383-70620405 CATTTCTAACTCAGTCTGTGTGG - Intronic
1055287038 9:74739774-74739796 CCTTTCTTCCTGAGGTTGTGCGG - Exonic
1055924527 9:81496067-81496089 CAGTCCTAAGTGAGGCTGTCAGG - Intergenic
1056604038 9:88070592-88070614 CATTTCTAATTGAGGTTATTTGG - Intergenic
1057413182 9:94837042-94837064 CATTTCTAATTGAGCCTATTTGG - Intronic
1058620371 9:106876920-106876942 CATTTCTAAGCCAGGCTATGGGG - Intronic
1058770976 9:108231491-108231513 CATTTCTTAATGAGGCTATTTGG - Intergenic
1058958107 9:109968096-109968118 GATTTAGGACTGAGGCTGTGTGG + Intronic
1060167862 9:121434457-121434479 CATTTCTTTCTGAGGCTCTAGGG - Intergenic
1185939050 X:4293782-4293804 CTTTTCTAACTGTATCTGTGGGG + Intergenic
1186664180 X:11701736-11701758 CATTTCCCAGTGAGGCAGTGAGG - Intergenic
1186809476 X:13174233-13174255 TATTTCTGACTGTGTCTGTGAGG + Intergenic
1188152971 X:26701850-26701872 CAATTATATCAGAGGCTGTGAGG + Intergenic
1190556804 X:51644027-51644049 TATTGCTAACTGAGCATGTGAGG + Intergenic
1190944398 X:55076790-55076812 CATTTCCTACTGCTGCTGTGTGG + Intronic
1190945642 X:55090723-55090745 CATTTCCTACTGCTGCTGTGTGG + Intronic
1190958588 X:55221988-55222010 CATTTCTTACTGCTGCTGTGCGG + Intronic
1190964196 X:55282084-55282106 CATTTCTTACTGCTGCTGTGCGG + Intronic
1193035714 X:76948903-76948925 CATTCCTAACTCATTCTGTGAGG - Intergenic
1193061847 X:77215230-77215252 CATTGCTATCTGTGGCTGTCTGG + Intergenic
1194581430 X:95676841-95676863 ATTTTCTAACTGATGCTTTGGGG - Intergenic
1194634013 X:96321783-96321805 CATTTCTAATTGAGTTTGTTTGG + Intergenic
1194755669 X:97736248-97736270 TATTTCTCACTGTGTCTGTGAGG + Intergenic
1194869415 X:99109859-99109881 CACTTCTAAGTGAGAATGTGTGG - Intergenic
1195319998 X:103714069-103714091 CAATTACCACTGAGGCTGTGAGG - Intronic
1196352672 X:114750721-114750743 AATTTTAAACTGAGGCTCTGTGG + Intronic
1197504173 X:127281203-127281225 CATTTCTCACTGAGCCTATTTGG - Intergenic
1198389031 X:136155072-136155094 CATTTCTTTCTGTAGCTGTGAGG + Intronic
1199496588 X:148458979-148459001 ACTTTCTATCTGAGGCTGGGAGG + Intergenic
1200399939 X:156013531-156013553 TATTTATAACAGGGGCTGTGTGG + Intergenic
1200695412 Y:6354333-6354355 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1200908202 Y:8507454-8507476 CATTTCAACCTGAGGCTTGGTGG - Intergenic
1200922626 Y:8626853-8626875 CATTTCGGAAAGAGGCTGTGTGG - Intergenic
1200936399 Y:8742134-8742156 CCTTTCCAAAAGAGGCTGTGTGG + Intergenic
1201039865 Y:9820377-9820399 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1202198735 Y:22325135-22325157 CATTTCAACCTGAGGCTTGGAGG - Intronic
1202231381 Y:22662703-22662725 CATTTCAACCTGAGGCTTGGAGG - Intergenic
1202311777 Y:23533462-23533484 CATTTCAACCTGAGGCTTGGAGG + Intergenic
1202559025 Y:26137132-26137154 CATTTCAACCTGAGGCTTGGAGG - Intergenic