ID: 995099878

View in Genome Browser
Species Human (GRCh38)
Location 5:108287096-108287118
Sequence TGATTTTTATAGATGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19956
Summary {0: 1, 1: 34, 2: 586, 3: 6077, 4: 13258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995099878 Original CRISPR TGATTTTTATAGATGGTGTA AGG (reversed) Intronic
Too many off-targets to display for this crispr