ID: 995106602

View in Genome Browser
Species Human (GRCh38)
Location 5:108382298-108382320
Sequence TAAGGTTTTTCCGAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995106596_995106602 -10 Left 995106596 5:108382285-108382307 CCCTCCCACCGCCTAAGGTTTTT 0: 1
1: 0
2: 0
3: 3
4: 123
Right 995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 112
995106595_995106602 -7 Left 995106595 5:108382282-108382304 CCTCCCTCCCACCGCCTAAGGTT 0: 1
1: 0
2: 0
3: 9
4: 162
Right 995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 112
995106592_995106602 -5 Left 995106592 5:108382280-108382302 CCCCTCCCTCCCACCGCCTAAGG 0: 1
1: 0
2: 1
3: 27
4: 343
Right 995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 112
995106594_995106602 -6 Left 995106594 5:108382281-108382303 CCCTCCCTCCCACCGCCTAAGGT 0: 1
1: 0
2: 0
3: 7
4: 205
Right 995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995106602 Original CRISPR TAAGGTTTTTCCGAAGCTGC TGG Intergenic
902942959 1:19813766-19813788 GATGGTGTTTCTGAAGCTGCAGG - Intergenic
906301364 1:44684369-44684391 TAAGGTTTTTCAGAAGTAGGGGG - Intronic
909829814 1:80173717-80173739 TAAGGACTTTCTCAAGCTGCAGG - Intergenic
910194623 1:84627790-84627812 AAAGGTTATTCCCAAACTGCAGG - Intergenic
911286931 1:96006382-96006404 GCAGGTTTTTCCGAAGTTTCAGG - Intergenic
912107025 1:106291898-106291920 TAATGCTTTTCCAAAGGTGCCGG - Intergenic
915320618 1:155054128-155054150 TAATGTTGTTCCCATGCTGCAGG + Exonic
916025078 1:160826597-160826619 AAGGGTTTTTCAGAAGCTGAAGG + Intronic
1065983378 10:30925711-30925733 TAAGGTTCCTCAGAAGCAGCAGG + Intronic
1070787945 10:79173038-79173060 TATGATTTTTCCAAATCTGCTGG + Intronic
1078103096 11:8341368-8341390 TTAGGTTGTCCGGAAGCTGCTGG - Intergenic
1079262208 11:18893964-18893986 TAAGGTTTTTCATGTGCTGCTGG + Intergenic
1079530552 11:21447274-21447296 TGAGCTTTTTCCTAAGCTTCAGG + Intronic
1081521281 11:43883726-43883748 CAAGATTTTTCCAGAGCTGCTGG + Intronic
1086579605 11:88384043-88384065 TTAGGTTTCTCTGAAGCTTCAGG + Intergenic
1087274123 11:96143472-96143494 CTAGTTTTATCCGAAGCTGCAGG + Intronic
1090114917 11:123958940-123958962 TTAGGTTTTTGCTATGCTGCTGG + Intergenic
1093806374 12:23438041-23438063 TAAGCTTTTTGATAAGCTGCTGG - Intergenic
1096051313 12:48611345-48611367 TAAGGTTTTTGATATGCTGCTGG + Intergenic
1098694977 12:73540957-73540979 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1100080130 12:90838918-90838940 TAAGGTTACTCCAAAGCTGCCGG - Intergenic
1101327507 12:103728914-103728936 TCAGGTTTTCCAGAAGCAGCTGG - Exonic
1103054945 12:117811395-117811417 TCAGGTGTTGCCGATGCTGCTGG - Intronic
1104032609 12:125075913-125075935 AAAAGTTTTTTCTAAGCTGCAGG - Intronic
1106071178 13:26412552-26412574 TAAGGCTTTTCAGAAGGTCCCGG + Intergenic
1106255421 13:28018300-28018322 AAAGGTTTTTCTGCAGCTTCAGG - Intronic
1109891562 13:68620874-68620896 TAAGCTTTTTCATATGCTGCTGG - Intergenic
1110652856 13:77962404-77962426 TAAGGTTTTTCATGTGCTGCTGG - Intergenic
1112087702 13:96049104-96049126 TAAGCTTTTTGAGATGCTGCTGG - Intronic
1112879416 13:104087546-104087568 TAAGGTTTTTTGGAAGTTGTAGG - Intergenic
1117002771 14:51388191-51388213 TAAAGTTTTTCTGAAGCTAGAGG - Intergenic
1122707010 14:103628249-103628271 GAGGGTTTTTCCCAAGCCGCTGG + Intronic
1125674703 15:41495740-41495762 TCAGGCTTTTCCGAAGAGGCGGG - Intronic
1126469452 15:48992438-48992460 TAAGGGTTTTTCCAAGCTGAAGG + Exonic
1130320791 15:82838946-82838968 AAAGGTTTTTCCAGAGCTGTTGG - Intronic
1134289908 16:12896043-12896065 TAAGCATTTTCAGAAGCAGCAGG - Intergenic
1136727367 16:32371088-32371110 TAAGCTTTTTGCTATGCTGCTGG - Intergenic
1140433387 16:74923970-74923992 TGAGGTATTTCCGAGGCTGGCGG + Exonic
1202999066 16_KI270728v1_random:146662-146684 TAAGCTTTTTGCTATGCTGCTGG + Intergenic
1203130664 16_KI270728v1_random:1683070-1683092 TAAGCTTTTTGCTATGCTGCTGG + Intergenic
1146296671 17:31655519-31655541 CAGGGTTTTTCCGATGCAGCAGG - Intergenic
1153702017 18:7704041-7704063 TAAGGTTTTTGATATGCTGCTGG + Intronic
1159902113 18:74056996-74057018 TAAGGTTTTTAATGAGCTGCTGG - Intergenic
1160475081 18:79176746-79176768 GAAGGTTTTTCCTGAGCTACAGG - Intronic
1162010151 19:7808355-7808377 TTAGGGTTTTCCAAGGCTGCAGG + Intergenic
1165660570 19:37576974-37576996 TAAGGTTTTGCAGAAGATGGCGG - Intronic
926848432 2:17167947-17167969 TAAGGTTTCTCCCATGCTGTAGG + Intergenic
931036225 2:58246042-58246064 TAAGGTGATGCCGATGCTGCTGG - Intergenic
931195650 2:60050106-60050128 TAAGGATTTTAAGAAGCTGGGGG - Intergenic
932174630 2:69588335-69588357 TAGAGTTTTTCTGAAGGTGCAGG - Intronic
933534455 2:83554680-83554702 TAAGCTTTTTCACATGCTGCTGG + Intergenic
935961820 2:108433121-108433143 TAAGGTTTTTGATATGCTGCTGG - Intergenic
936642911 2:114335477-114335499 TAAGGTTTTTGCTGTGCTGCTGG + Intergenic
940584288 2:155625149-155625171 TCAGGTGTTTCCGATGCTGCTGG + Intergenic
940641829 2:156353014-156353036 GAAGGTTATTCCCAAGTTGCTGG + Intergenic
941059936 2:160835543-160835565 CAAGGTTCTTCCTTAGCTGCAGG - Intergenic
946684725 2:222256247-222256269 TAAGGGTTTTCAGAATTTGCAGG + Intronic
1180241427 21:46509291-46509313 TCAGGGTGTTCAGAAGCTGCTGG - Exonic
1184974120 22:48048799-48048821 TAAGGTTCTGCCAAGGCTGCAGG + Intergenic
951797585 3:26557960-26557982 TAATGCTTTTGCCAAGCTGCAGG + Intergenic
952503383 3:33985551-33985573 TAAGTTTTTTGAGATGCTGCTGG + Intergenic
954493367 3:50929402-50929424 TATGGTTTTTAGCAAGCTGCAGG - Intronic
957917531 3:86705697-86705719 TAAGCTTTTTCATATGCTGCTGG + Intergenic
959121903 3:102242560-102242582 TCAGGGTTTTACAAAGCTGCTGG - Intronic
965163534 3:165166165-165166187 TAAGGTTTTTGATATGCTGCTGG + Intergenic
970166344 4:13242232-13242254 TAAGATTTTCCAGAAGCTCCAGG + Intergenic
972269707 4:37499192-37499214 TAAGCTTTTTGCTATGCTGCTGG + Intronic
972451389 4:39202937-39202959 TTAGTTTTTTCCAAAACTGCAGG + Intronic
976651962 4:87445434-87445456 TAAACTTTTTCAGAAGCTCCGGG + Intronic
976716365 4:88126550-88126572 TAAGGTTTTTGATATGCTGCTGG - Intronic
977455081 4:97248811-97248833 GAAGTTTTTTCTGAAGCTGAAGG - Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
983182946 4:164669935-164669957 TAAGCTTTTTCATGAGCTGCTGG - Intergenic
983260945 4:165455960-165455982 AAAGGTTTTTCTGAATCTGAAGG + Intronic
983567297 4:169166748-169166770 AATGGTTTTCCCGAAGCAGCTGG + Intronic
994917702 5:106001412-106001434 TAAGCTTTTTATGATGCTGCTGG + Intergenic
995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG + Intergenic
996668586 5:126089724-126089746 TAAGCTTTTTGAGGAGCTGCTGG - Intergenic
998302151 5:141033193-141033215 TCAGTTTTATCAGAAGCTGCAGG + Intergenic
998404777 5:141868125-141868147 TGAGGTTTTCCTGAAGCTGGAGG - Intronic
999231273 5:150063572-150063594 TCAGGTCTTTCCAAAGGTGCTGG - Intronic
1002903662 6:1430973-1430995 TAAGGTTTTTGAGGTGCTGCTGG + Intergenic
1008865780 6:56207807-56207829 TAAGGTTTTTGATATGCTGCTGG - Intronic
1010828810 6:80505935-80505957 TTAGGTTTTCCAGAAGCTGTTGG - Intergenic
1017145792 6:151233553-151233575 TTAGTTTTTTAAGAAGCTGCCGG + Intergenic
1017284447 6:152658277-152658299 TAAGGTTGTTCTGAGGTTGCAGG + Intergenic
1019357949 7:590745-590767 TGAGGTTTTTCTGGACCTGCTGG - Intronic
1022102803 7:27179146-27179168 AAAGGTTTTCTCCAAGCTGCCGG + Intronic
1023277589 7:38536710-38536732 TATTATTTTTCAGAAGCTGCAGG + Intronic
1027731616 7:81881463-81881485 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1036406760 8:8462100-8462122 GAAGGTTTTTCCCTAACTGCAGG - Intergenic
1037801315 8:22037399-22037421 AAAGGTTTTTTTGAAGGTGCGGG - Intergenic
1038656698 8:29459322-29459344 AAAGGCCTTTCAGAAGCTGCAGG - Intergenic
1039185266 8:34909573-34909595 TAATGTTTGTCTGCAGCTGCTGG - Intergenic
1042116450 8:65437067-65437089 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1044113791 8:88309000-88309022 TTAAGTTTTTCCTAATCTGCTGG - Intronic
1049142646 8:140970072-140970094 TGGAGTTTCTCCGAAGCTGCTGG - Intronic
1049253900 8:141603921-141603943 TAAGGTTTTTCACAGGCTCCAGG + Intergenic
1050223664 9:3425442-3425464 TAAGGTTTTGCTGAATCTGTGGG - Intronic
1052667664 9:31515744-31515766 TAAGCTTTTTCAGGTGCTGCTGG + Intergenic
1052696491 9:31885526-31885548 TAAGCTTTTTCAGGTGCTGCTGG + Intergenic
1055629796 9:78212067-78212089 GAAGGTGTCTCTGAAGCTGCTGG - Intergenic
1056713798 9:89012314-89012336 CAAGGTTTCTCCGTTGCTGCAGG - Intergenic
1056900057 9:90590471-90590493 TAAGGTTTTTCTGAGGATGTTGG - Intergenic
1057425041 9:94941486-94941508 TAAAGTTTTTCAGAAAATGCTGG - Intronic
1060498856 9:124137719-124137741 TAGGGTTTTTCCAAGGCAGCTGG + Intergenic
1062574301 9:137199420-137199442 TCAGCTTCTTCCGAAGCAGCCGG + Exonic
1191925782 X:66308179-66308201 TAAGGTTTTTGATATGCTGCTGG + Intergenic
1192269856 X:69568823-69568845 TGAGGTTTTTTAGCAGCTGCTGG + Intergenic
1193745550 X:85275338-85275360 TAAGGCTTTAGAGAAGCTGCAGG + Intergenic
1194511978 X:94808010-94808032 TAAGCTTTTTCGTATGCTGCTGG + Intergenic
1194939713 X:99995060-99995082 TAGGGTTTTCCCCAAGATGCTGG - Intergenic
1199889218 X:152058390-152058412 TAAGGTTTTTGATATGCTGCTGG - Intergenic
1200878834 Y:8190233-8190255 TAAGGTTTTTGATATGCTGCTGG + Intergenic
1201263615 Y:12184601-12184623 TAAGCTTTTTCATATGCTGCTGG - Intergenic
1201897908 Y:19013282-19013304 GAAGGTTTTTCCTGAGCTACAGG + Intergenic