ID: 995108250

View in Genome Browser
Species Human (GRCh38)
Location 5:108399323-108399345
Sequence CTGGGGAAAGCAGCGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995108246_995108250 -8 Left 995108246 5:108399308-108399330 CCTGCGACAGAGCACCTGGGGAA No data
Right 995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG No data
995108238_995108250 28 Left 995108238 5:108399272-108399294 CCCCAGTCAGGGACTTTTAGATA No data
Right 995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG No data
995108241_995108250 -1 Left 995108241 5:108399301-108399323 CCATCTCCCTGCGACAGAGCACC No data
Right 995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG No data
995108240_995108250 26 Left 995108240 5:108399274-108399296 CCAGTCAGGGACTTTTAGATAAA No data
Right 995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG No data
995108239_995108250 27 Left 995108239 5:108399273-108399295 CCCAGTCAGGGACTTTTAGATAA No data
Right 995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG No data
995108245_995108250 -7 Left 995108245 5:108399307-108399329 CCCTGCGACAGAGCACCTGGGGA No data
Right 995108250 5:108399323-108399345 CTGGGGAAAGCAGCGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995108250 Original CRISPR CTGGGGAAAGCAGCGGCTGT GGG Intergenic
No off target data available for this crispr