ID: 995109571

View in Genome Browser
Species Human (GRCh38)
Location 5:108413817-108413839
Sequence CAAGGAGCAAACAAAGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995109565_995109571 13 Left 995109565 5:108413781-108413803 CCAGAAAGGTTTTAAAAACAAGG No data
Right 995109571 5:108413817-108413839 CAAGGAGCAAACAAAGATATAGG No data
995109569_995109571 -10 Left 995109569 5:108413804-108413826 CCAAAGGAGAATCCAAGGAGCAA No data
Right 995109571 5:108413817-108413839 CAAGGAGCAAACAAAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995109571 Original CRISPR CAAGGAGCAAACAAAGATAT AGG Intergenic
No off target data available for this crispr