ID: 995109846

View in Genome Browser
Species Human (GRCh38)
Location 5:108417101-108417123
Sequence AGCAGGAGCTTCTAGGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995109846_995109849 -2 Left 995109846 5:108417101-108417123 CCTATGACCTAGAAGCTCCTGCT No data
Right 995109849 5:108417122-108417144 CTTTGAGTTGTCCACCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995109846 Original CRISPR AGCAGGAGCTTCTAGGTCAT AGG (reversed) Intergenic
No off target data available for this crispr