ID: 995109915

View in Genome Browser
Species Human (GRCh38)
Location 5:108417853-108417875
Sequence TTATAGGCTCAGAACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995109915_995109926 20 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109926 5:108417896-108417918 TGGGGATACTACCTGCCTTTGGG No data
995109915_995109925 19 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109925 5:108417895-108417917 ATGGGGATACTACCTGCCTTTGG No data
995109915_995109929 25 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109929 5:108417901-108417923 ATACTACCTGCCTTTGGGTGGGG No data
995109915_995109927 23 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109927 5:108417899-108417921 GGATACTACCTGCCTTTGGGTGG No data
995109915_995109922 2 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109922 5:108417878-108417900 ACCTCACACTCAGCCACATGGGG No data
995109915_995109928 24 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109928 5:108417900-108417922 GATACTACCTGCCTTTGGGTGGG No data
995109915_995109921 1 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109921 5:108417877-108417899 AACCTCACACTCAGCCACATGGG No data
995109915_995109920 0 Left 995109915 5:108417853-108417875 CCTCCCCAGTTCTGAGCCTATAA No data
Right 995109920 5:108417876-108417898 AAACCTCACACTCAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995109915 Original CRISPR TTATAGGCTCAGAACTGGGG AGG (reversed) Intergenic
No off target data available for this crispr