ID: 995111048

View in Genome Browser
Species Human (GRCh38)
Location 5:108428872-108428894
Sequence CATCCCTCCTCCAAGGAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995111038_995111048 29 Left 995111038 5:108428820-108428842 CCCCTTCCCCAAAGAGCTCAAAC No data
Right 995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG No data
995111043_995111048 21 Left 995111043 5:108428828-108428850 CCAAAGAGCTCAAACAGCTTAGA No data
Right 995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG No data
995111042_995111048 22 Left 995111042 5:108428827-108428849 CCCAAAGAGCTCAAACAGCTTAG No data
Right 995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG No data
995111040_995111048 27 Left 995111040 5:108428822-108428844 CCTTCCCCAAAGAGCTCAAACAG No data
Right 995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG No data
995111039_995111048 28 Left 995111039 5:108428821-108428843 CCCTTCCCCAAAGAGCTCAAACA No data
Right 995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG No data
995111041_995111048 23 Left 995111041 5:108428826-108428848 CCCCAAAGAGCTCAAACAGCTTA No data
Right 995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995111048 Original CRISPR CATCCCTCCTCCAAGGAGTT CGG Intergenic
No off target data available for this crispr