ID: 995112385

View in Genome Browser
Species Human (GRCh38)
Location 5:108442301-108442323
Sequence GCCAGCCGGCCCGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995112385_995112387 -8 Left 995112385 5:108442301-108442323 CCGGGGCTTGCGGGCCGGCTGGC No data
Right 995112387 5:108442316-108442338 CGGCTGGCCACTCTGAGTGCAGG No data
995112385_995112388 -7 Left 995112385 5:108442301-108442323 CCGGGGCTTGCGGGCCGGCTGGC No data
Right 995112388 5:108442317-108442339 GGCTGGCCACTCTGAGTGCAGGG No data
995112385_995112395 29 Left 995112385 5:108442301-108442323 CCGGGGCTTGCGGGCCGGCTGGC No data
Right 995112395 5:108442353-108442375 CGCCCACCCAGAACTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995112385 Original CRISPR GCCAGCCGGCCCGCAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr