ID: 995125595

View in Genome Browser
Species Human (GRCh38)
Location 5:108574491-108574513
Sequence AGCGAAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995125590_995125595 24 Left 995125590 5:108574444-108574466 CCTGCTGGATCTGGAGGGATGGA No data
Right 995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG No data
995125588_995125595 25 Left 995125588 5:108574443-108574465 CCCTGCTGGATCTGGAGGGATGG No data
Right 995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995125595 Original CRISPR AGCGAAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr