ID: 995131671

View in Genome Browser
Species Human (GRCh38)
Location 5:108637004-108637026
Sequence AATGATCGTTTATAAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995131671_995131672 -5 Left 995131671 5:108637004-108637026 CCTCTCACTTATAAACGATCATT No data
Right 995131672 5:108637022-108637044 TCATTATGCATGAATTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995131671 Original CRISPR AATGATCGTTTATAAGTGAG AGG (reversed) Intergenic
No off target data available for this crispr