ID: 995132386

View in Genome Browser
Species Human (GRCh38)
Location 5:108644234-108644256
Sequence AGTAATGTAAGTACAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995132378_995132386 19 Left 995132378 5:108644192-108644214 CCCTTGGGTTCTGCCATTCAGGC No data
Right 995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG No data
995132382_995132386 6 Left 995132382 5:108644205-108644227 CCATTCAGGCAAGGACTTGGAAG No data
Right 995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG No data
995132379_995132386 18 Left 995132379 5:108644193-108644215 CCTTGGGTTCTGCCATTCAGGCA No data
Right 995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995132386 Original CRISPR AGTAATGTAAGTACAGGTAG GGG Intergenic
No off target data available for this crispr