ID: 995138830

View in Genome Browser
Species Human (GRCh38)
Location 5:108710354-108710376
Sequence CACTCCCGCTAGAAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995138824_995138830 14 Left 995138824 5:108710317-108710339 CCATAAGTCTGAGATGAACGTGT No data
Right 995138830 5:108710354-108710376 CACTCCCGCTAGAAGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995138830 Original CRISPR CACTCCCGCTAGAAGATCTA GGG Intergenic
No off target data available for this crispr