ID: 995146659

View in Genome Browser
Species Human (GRCh38)
Location 5:108794708-108794730
Sequence TCTTACATGGCAGGAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2271
Summary {0: 1, 1: 5, 2: 66, 3: 511, 4: 1688}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995146659_995146664 10 Left 995146659 5:108794708-108794730 CCACTCTCTCCTGCCATGTAAGA 0: 1
1: 5
2: 66
3: 511
4: 1688
Right 995146664 5:108794741-108794763 AAAGGCTGCTGCCACACATGTGG 0: 1
1: 0
2: 3
3: 13
4: 182
995146659_995146662 -8 Left 995146659 5:108794708-108794730 CCACTCTCTCCTGCCATGTAAGA 0: 1
1: 5
2: 66
3: 511
4: 1688
Right 995146662 5:108794723-108794745 ATGTAAGATTTCCACTGAAAAGG 0: 1
1: 0
2: 9
3: 55
4: 238
995146659_995146667 22 Left 995146659 5:108794708-108794730 CCACTCTCTCCTGCCATGTAAGA 0: 1
1: 5
2: 66
3: 511
4: 1688
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data
995146659_995146665 11 Left 995146659 5:108794708-108794730 CCACTCTCTCCTGCCATGTAAGA 0: 1
1: 5
2: 66
3: 511
4: 1688
Right 995146665 5:108794742-108794764 AAGGCTGCTGCCACACATGTGGG 0: 1
1: 1
2: 10
3: 190
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995146659 Original CRISPR TCTTACATGGCAGGAGAGAG TGG (reversed) Intronic