ID: 995146660 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:108794717-108794739 |
| Sequence | CAGTGGAAATCTTACATGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1174 | |||
| Summary | {0: 1, 1: 2, 2: 39, 3: 384, 4: 748} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995146660_995146665 | 2 | Left | 995146660 | 5:108794717-108794739 | CCTGCCATGTAAGATTTCCACTG | 0: 1 1: 2 2: 39 3: 384 4: 748 |
||
| Right | 995146665 | 5:108794742-108794764 | AAGGCTGCTGCCACACATGTGGG | 0: 1 1: 1 2: 10 3: 190 4: 599 |
||||
| 995146660_995146664 | 1 | Left | 995146660 | 5:108794717-108794739 | CCTGCCATGTAAGATTTCCACTG | 0: 1 1: 2 2: 39 3: 384 4: 748 |
||
| Right | 995146664 | 5:108794741-108794763 | AAAGGCTGCTGCCACACATGTGG | 0: 1 1: 0 2: 3 3: 13 4: 182 |
||||
| 995146660_995146667 | 13 | Left | 995146660 | 5:108794717-108794739 | CCTGCCATGTAAGATTTCCACTG | 0: 1 1: 2 2: 39 3: 384 4: 748 |
||
| Right | 995146667 | 5:108794753-108794775 | CACACATGTGGGATCTCCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995146660 | Original CRISPR | CAGTGGAAATCTTACATGGC AGG (reversed) | Intronic | ||