ID: 995146660

View in Genome Browser
Species Human (GRCh38)
Location 5:108794717-108794739
Sequence CAGTGGAAATCTTACATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1174
Summary {0: 1, 1: 2, 2: 39, 3: 384, 4: 748}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995146660_995146665 2 Left 995146660 5:108794717-108794739 CCTGCCATGTAAGATTTCCACTG 0: 1
1: 2
2: 39
3: 384
4: 748
Right 995146665 5:108794742-108794764 AAGGCTGCTGCCACACATGTGGG 0: 1
1: 1
2: 10
3: 190
4: 599
995146660_995146664 1 Left 995146660 5:108794717-108794739 CCTGCCATGTAAGATTTCCACTG 0: 1
1: 2
2: 39
3: 384
4: 748
Right 995146664 5:108794741-108794763 AAAGGCTGCTGCCACACATGTGG 0: 1
1: 0
2: 3
3: 13
4: 182
995146660_995146667 13 Left 995146660 5:108794717-108794739 CCTGCCATGTAAGATTTCCACTG 0: 1
1: 2
2: 39
3: 384
4: 748
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995146660 Original CRISPR CAGTGGAAATCTTACATGGC AGG (reversed) Intronic