ID: 995146661

View in Genome Browser
Species Human (GRCh38)
Location 5:108794721-108794743
Sequence TTTTCAGTGGAAATCTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995146661_995146667 9 Left 995146661 5:108794721-108794743 CCATGTAAGATTTCCACTGAAAA No data
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data
995146661_995146664 -3 Left 995146661 5:108794721-108794743 CCATGTAAGATTTCCACTGAAAA No data
Right 995146664 5:108794741-108794763 AAAGGCTGCTGCCACACATGTGG 0: 1
1: 0
2: 3
3: 13
4: 182
995146661_995146665 -2 Left 995146661 5:108794721-108794743 CCATGTAAGATTTCCACTGAAAA No data
Right 995146665 5:108794742-108794764 AAGGCTGCTGCCACACATGTGGG 0: 1
1: 1
2: 10
3: 190
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995146661 Original CRISPR TTTTCAGTGGAAATCTTACA TGG (reversed) Intronic