ID: 995146663

View in Genome Browser
Species Human (GRCh38)
Location 5:108794734-108794756
Sequence TGTGGCAGCAGCCTTTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1650
Summary {0: 1, 1: 13, 2: 295, 3: 576, 4: 765}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995146663_995146667 -4 Left 995146663 5:108794734-108794756 CCACTGAAAAGGCTGCTGCCACA 0: 1
1: 13
2: 295
3: 576
4: 765
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995146663 Original CRISPR TGTGGCAGCAGCCTTTTCAG TGG (reversed) Intronic