ID: 995146667

View in Genome Browser
Species Human (GRCh38)
Location 5:108794753-108794775
Sequence CACACATGTGGGATCTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995146663_995146667 -4 Left 995146663 5:108794734-108794756 CCACTGAAAAGGCTGCTGCCACA 0: 1
1: 13
2: 295
3: 576
4: 765
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data
995146660_995146667 13 Left 995146660 5:108794717-108794739 CCTGCCATGTAAGATTTCCACTG 0: 1
1: 2
2: 39
3: 384
4: 748
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data
995146659_995146667 22 Left 995146659 5:108794708-108794730 CCACTCTCTCCTGCCATGTAAGA 0: 1
1: 5
2: 66
3: 511
4: 1688
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data
995146661_995146667 9 Left 995146661 5:108794721-108794743 CCATGTAAGATTTCCACTGAAAA No data
Right 995146667 5:108794753-108794775 CACACATGTGGGATCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995146667 Original CRISPR CACACATGTGGGATCTCCAT TGG Intronic