ID: 995150034

View in Genome Browser
Species Human (GRCh38)
Location 5:108832359-108832381
Sequence GATGCAGGTTAAGATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995150034 Original CRISPR GATGCAGGTTAAGATGTGGA TGG Intronic
902625980 1:17676649-17676671 GATGCAGGGTCAGATGTGATAGG - Intronic
902666352 1:17941649-17941671 GATGCTGGCTGAGATGTGGCAGG + Intergenic
903042638 1:20542828-20542850 GGTGCAGCTTCTGATGTGGAGGG - Intergenic
906760364 1:48372012-48372034 AATTCAAGTTAAGATTTGGATGG + Intronic
907392417 1:54166917-54166939 AATTCAAGTTAAGATTTGGAAGG + Intronic
909849367 1:80441074-80441096 GAGGGAGGTAAAGATGTGGAAGG - Intergenic
911257505 1:95648679-95648701 GATTCAAGTTAAGATTTGGGTGG + Intergenic
912608084 1:111013487-111013509 GATGCTGGTGAGGCTGTGGAGGG + Intergenic
915108467 1:153548580-153548602 GATGGAGGTTAAGATGGGTCTGG - Intronic
915457644 1:156051271-156051293 GAGGCAGGGTCAGGTGTGGAGGG + Exonic
915663444 1:157423114-157423136 GATGCAGTTTGAAATGGGGAAGG - Intergenic
916855159 1:168741659-168741681 CATCCAAGTTAAAATGTGGAGGG - Intergenic
917343972 1:174009413-174009435 CATGCAGTTTAACATGTGGTTGG - Intronic
917699875 1:177569574-177569596 GATGCAGGCTGAGAGGTAGAGGG - Intergenic
917995777 1:180437135-180437157 GATACAGATGAAGATGTCGAGGG - Intronic
920041880 1:203103361-203103383 GAAGCAGGGGAAGATGGGGAAGG - Intronic
920275259 1:204799746-204799768 GAGGGGGGTTAAGATATGGATGG - Intergenic
924063178 1:240197305-240197327 GATGCAGATGAAGAGATGGATGG - Intronic
1064207881 10:13339865-13339887 TATGCAGGGAAAGAAGTGGATGG - Intronic
1065390010 10:25174082-25174104 TATGCAAGTAAAGATGTGTAAGG - Intergenic
1065978097 10:30861404-30861426 GATGCAGAACAGGATGTGGAGGG + Intronic
1067085372 10:43235354-43235376 GAGGCAGAATAGGATGTGGAAGG - Intronic
1067956402 10:50795855-50795877 AATTCAAGTTAAGATTTGGATGG - Intronic
1069829080 10:71271698-71271720 GAGGCAGGTGAAGAAGTGGATGG - Intronic
1072620164 10:97074460-97074482 GATGCAGGCTCAGAAGGGGAAGG + Intronic
1073058564 10:100718475-100718497 GAGGCAGTCTGAGATGTGGATGG - Intergenic
1073078287 10:100838444-100838466 GATGCAGGTTGACCTGTGGAAGG + Intergenic
1073101472 10:101008880-101008902 GATGCAGGGTGACATGAGGAGGG - Intronic
1073458231 10:103650536-103650558 GATGCATGTGGAGGTGTGGAGGG - Intronic
1073615894 10:104994838-104994860 AATGCCCGTTAACATGTGGATGG - Intronic
1073760260 10:106621523-106621545 TTTGAAGGTTAAGGTGTGGATGG - Intronic
1075138649 10:119811138-119811160 GATGCAGCTGATGCTGTGGATGG - Intronic
1075622145 10:123935758-123935780 GATGCTGGTTATGATGGTGATGG - Intronic
1076315107 10:129534300-129534322 GCTGCAGGGTGAGATGTTGAAGG + Intronic
1077702685 11:4456354-4456376 TATGCAGGTTTAGATGTGGAGGG + Intergenic
1078444101 11:11391209-11391231 GATGCAGGTTGAGATGGGAAGGG - Intronic
1079780643 11:24598532-24598554 GGTGCAAGTGAAGATGAGGAGGG + Intronic
1084687029 11:70702511-70702533 GATGCTGGTGAAGAAGAGGATGG - Intronic
1086231556 11:84576917-84576939 AATTCAAGTTAAGATTTGGATGG - Intronic
1086954236 11:92919357-92919379 GATGGAGGTGGATATGTGGAGGG + Intergenic
1088573093 11:111242049-111242071 AATGAAGGTAAAGGTGTGGAGGG - Intergenic
1090475028 11:127012691-127012713 GAGGCTGGATCAGATGTGGATGG - Intergenic
1093938331 12:25025431-25025453 GATGCAGGCCAAGAGCTGGAGGG + Intronic
1093943024 12:25075701-25075723 TATGCAGGTTAATATTTGAATGG + Intronic
1094056011 12:26270194-26270216 GTTGCAGGTTATGCTGTGCAAGG + Intronic
1095614760 12:44175217-44175239 GATGGAGCTTAAGGTGTTGATGG + Intronic
1096559897 12:52428602-52428624 GAAGCAGGTAAAGATTTGGCAGG - Exonic
1097489634 12:60249988-60250010 AATGAAGGTTAACATTTGGATGG - Intergenic
1097614700 12:61870125-61870147 AATGCAGGTCAACATTTGGAAGG + Intronic
1099503803 12:83447274-83447296 GATTCAAGTTGAGATTTGGATGG - Intergenic
1100811725 12:98345285-98345307 AATTCAAGTTAAGATTTGGATGG + Intergenic
1103302278 12:119937215-119937237 GATGTAGGCTAGGATGGGGAGGG - Intergenic
1103764931 12:123272876-123272898 GATGGGGGTTAAGCTGGGGAGGG - Intergenic
1104681996 12:130758587-130758609 GATGTGGGTGTAGATGTGGATGG + Intergenic
1106568277 13:30905787-30905809 AATGCAGGGTACGATCTGGATGG + Intergenic
1106806954 13:33319233-33319255 GATGCATGTTACAATATGGATGG + Intronic
1108216831 13:48193703-48193725 GATTCATGCTATGATGTGGATGG - Intergenic
1110583044 13:77154721-77154743 AATACACGTTAAGATGTTGAAGG - Intronic
1111560114 13:89933305-89933327 TATGCAGGTAAAGGTGTGCATGG + Intergenic
1115149946 14:30272983-30273005 GAAGCATGTTCAAATGTGGAGGG - Intergenic
1115588772 14:34842527-34842549 GATTCAGGTTATGTTGTTGAGGG - Intronic
1117267577 14:54105984-54106006 TATGCATCTTAAGATGTAGAGGG - Intergenic
1118749184 14:68794211-68794233 AATGAAGGTAAAGAGGTGGAGGG + Intronic
1119386970 14:74263467-74263489 GGTTGAGGGTAAGATGTGGAAGG - Intergenic
1122502247 14:102208470-102208492 ACTGCAGGATAAAATGTGGAGGG + Intronic
1122523025 14:102360139-102360161 GATGTACGTGATGATGTGGAGGG - Intronic
1122952279 14:105051639-105051661 GATGCAGGCGGAGATGAGGATGG + Exonic
1124708036 15:31981801-31981823 TGTGCAGGTTATGATGGGGAAGG + Intergenic
1124846936 15:33300478-33300500 GATGCTGGTTGTCATGTGGAAGG - Intergenic
1124846998 15:33301003-33301025 GCTGCAGGGAGAGATGTGGATGG - Intergenic
1126740270 15:51770119-51770141 GATGCAGGTAGAGAGCTGGATGG - Intronic
1129149812 15:73681559-73681581 GATGGGGGTTCAGATGAGGATGG + Intergenic
1129866717 15:78914522-78914544 TATGCATGTTAAGATGATGACGG + Intergenic
1130827515 15:87564913-87564935 GGTGCAGGGCAAGAAGTGGAAGG - Intergenic
1134331854 16:13258863-13258885 GATTCAAGTTAAGATTTGGGTGG + Intergenic
1134987442 16:18665868-18665890 TATGTAGGTTTAGATGTAGAAGG + Intergenic
1135502741 16:23011400-23011422 GATGGATGTGAAGATGTTGATGG - Intergenic
1140854214 16:78963803-78963825 GATTCAAGTTAAGATTTGGGTGG - Intronic
1140976330 16:80063257-80063279 GATGGAGGTTGAGCAGTGGATGG - Intergenic
1142468751 17:150395-150417 GATGCAGGTTAAGCTGGACATGG - Intronic
1146958332 17:36950243-36950265 GATGAAGGGGAAGATGGGGAAGG + Exonic
1147505783 17:41015982-41016004 GCTGGAGGTGAAGATTTGGAAGG + Intronic
1151584732 17:75002183-75002205 GAGGCAGGGGAAGGTGTGGATGG - Exonic
1151629549 17:75301237-75301259 GAGGCAGATGAGGATGTGGAAGG - Intergenic
1152518753 17:80842787-80842809 GATGCAGGTCCAGATGTGAAAGG - Intronic
1153464715 18:5376613-5376635 GAGACAGGCCAAGATGTGGATGG + Intergenic
1153476680 18:5505649-5505671 GGTGGAGGTGAAGGTGTGGATGG - Intronic
1153476695 18:5505703-5505725 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476704 18:5505730-5505752 GGTGGAGGTGAAGGTGTGGATGG - Intronic
1153476712 18:5505757-5505779 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476721 18:5505784-5505806 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476738 18:5505838-5505860 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476747 18:5505865-5505887 GGTGGAGGTGAAGGTGTGGAAGG - Intronic
1153476755 18:5505892-5505914 GATGGAGGTGAAGGTGTGGAGGG - Intronic
1156482407 18:37444660-37444682 GATGCAGTTTCAGAGGAGGAAGG + Intronic
1159265428 18:66073186-66073208 GTTGCAGGTTCATAGGTGGAAGG - Intergenic
1160920047 19:1515337-1515359 GGTGGTGGTGAAGATGTGGAGGG + Intergenic
1163311855 19:16519615-16519637 GATGCTGGTGAAGATGGGTAAGG - Exonic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1165432303 19:35779917-35779939 GATGAAGGTGCAGAGGTGGATGG + Intronic
1166452616 19:42914897-42914919 GATGGAGGTTAAGATCTGAGGGG + Intronic
1167555998 19:50196102-50196124 GATGCAGGTTGAGCCCTGGAAGG + Intronic
1202711597 1_KI270714v1_random:22277-22299 GATGCAGCTGAAGATGTAGGAGG - Intergenic
926051368 2:9746932-9746954 GGGGCAGGTTAACATGAGGACGG - Intergenic
931381569 2:61758272-61758294 CAGGCAGGTGAAGATGAGGAGGG - Intergenic
931381697 2:61760037-61760059 TTTGCAGATTAAGATGTGAAGGG + Intergenic
932097309 2:68862889-68862911 AATGCAGGTTTACATCTGGATGG + Intergenic
935178240 2:100668161-100668183 GTTGCAGGTGAAGATTTTGAAGG + Intergenic
935401186 2:102662305-102662327 GATGCCCGTTAATCTGTGGAAGG + Intronic
937422012 2:121765180-121765202 GATGAAGGTGGAGATGTGGAGGG - Exonic
937915433 2:127096640-127096662 GATGCAGGTGATGGGGTGGATGG - Intronic
940019097 2:149138432-149138454 TAAGCAGGTGCAGATGTGGATGG + Intronic
940903973 2:159152166-159152188 GAAGCAGGGTAAGATGAGAATGG - Intronic
941085354 2:161111234-161111256 GATGGAGGGTTAGATCTGGAAGG + Intergenic
942394001 2:175526969-175526991 CATGCAGATAAAGATGGGGAAGG - Intergenic
944010033 2:194964375-194964397 AATTCAAGTTAAGATTTGGATGG + Intergenic
945818751 2:214637119-214637141 GCTGCAAGTTCAGATGTTGACGG - Intergenic
946947681 2:224838547-224838569 GATGCAGGTCCAGAACTGGATGG + Intronic
947859173 2:233346859-233346881 GATGCAGGAGAAGCTGAGGAGGG + Exonic
948790125 2:240372618-240372640 CATGGAGGGCAAGATGTGGAGGG + Intergenic
1169041129 20:2496455-2496477 CATGCTGGTTTTGATGTGGAGGG + Intronic
1172040751 20:32043418-32043440 GATACAGGCTATGATATGGACGG - Intergenic
1176678951 21:9807817-9807839 GATGCTGGTTAAGAGGTGGAAGG + Intergenic
1180748034 22:18105123-18105145 GATGGAGGTCATGATGTTGAGGG - Exonic
1181437037 22:22917101-22917123 GAGACAGGAGAAGATGTGGACGG + Intergenic
1181783059 22:25207015-25207037 GACCAAGGTTGAGATGTGGACGG - Intronic
1182714362 22:32343938-32343960 CCTACAGGTTAAGATGTGGGTGG - Intergenic
1183003431 22:34880375-34880397 GATGCAGGTTAAGCATTCGAAGG - Intergenic
1184463260 22:44652636-44652658 GATGAAAGTGAAGATGTAGACGG + Intergenic
1184463263 22:44652708-44652730 GATGAAAGTGAAGATGTAGACGG + Intergenic
950595976 3:13981939-13981961 GGTGCATGAGAAGATGTGGATGG - Intronic
951253800 3:20425830-20425852 GATGGAGGTTGAGAGGAGGAAGG - Intergenic
953790852 3:45946828-45946850 GATGCAGGTGAGGATGAGCATGG - Exonic
955403336 3:58609153-58609175 GATGCAGGTGAAGAGATGGCAGG + Intronic
957870205 3:86082438-86082460 AATGCAAGTTGAGATTTGGATGG + Intergenic
959171157 3:102846185-102846207 CATGCAGTTTAAGATGTGAAAGG + Intergenic
961493538 3:127274262-127274284 GATGCAGTTTAACATAGGGAGGG - Intergenic
962102664 3:132358970-132358992 GATAAAGGTGAAGCTGTGGATGG + Intronic
962731625 3:138289050-138289072 GCTGCAGTTTAACATGTGAATGG - Exonic
963222227 3:142825344-142825366 GATGACAGTTAAGATGAGGAGGG - Intronic
963225580 3:142858336-142858358 AATGCAGGTGAAGATGGAGATGG + Intronic
963519903 3:146350401-146350423 GATGCAGGCTTAGATGGGGGAGG + Intergenic
963732581 3:148987350-148987372 GAGGCAGGGTCAGGTGTGGAGGG + Intergenic
964745285 3:160006615-160006637 AATGCACGTTAATAAGTGGATGG - Intergenic
964753250 3:160071534-160071556 GGTGCAGCTTAGGATGTGGGAGG - Intergenic
964781588 3:160344943-160344965 AATGCTGGTGAGGATGTGGAGGG + Intronic
965391846 3:168114138-168114160 GCTGCAGGTGATGATGTGAAAGG - Intergenic
968085711 3:195873066-195873088 GAAGCAGGTGAAGCGGTGGAGGG - Intronic
970572489 4:17396621-17396643 GATGAAGATGAAGATGAGGATGG + Intergenic
975358498 4:73437703-73437725 TATGCAGGTTTGGATGTGCAAGG - Intronic
977934802 4:102789320-102789342 GATGCATGCTATAATGTGGATGG - Intergenic
978468888 4:109039540-109039562 AATCCAGATTTAGATGTGGAGGG - Intronic
978660104 4:111115858-111115880 GTTTCAGGTGAAGATGTGAATGG + Intergenic
981295135 4:143123101-143123123 GGTGCAGGTTAAGGTGCTGAAGG - Intergenic
982645863 4:158025178-158025200 ATTGCAGGTGAAGATGTGGACGG + Intergenic
982761419 4:159288871-159288893 GATCCAGCCAAAGATGTGGAAGG - Intronic
983765386 4:171475092-171475114 AATTCAAGTTAAGATTTGGATGG - Intergenic
985396597 4:189551127-189551149 GATGCTGGTTAAGAGGCGGAAGG - Intergenic
987895822 5:23944279-23944301 AATTCAAGTTAAGATTTGGATGG + Intergenic
988363473 5:30265938-30265960 GATGTAGGTAAAGATGTACATGG + Intergenic
988497681 5:31758711-31758733 GGGCCAGGTTAAGATGAGGATGG - Intronic
989439842 5:41457493-41457515 CATGCAGGTTATGCTGGGGAAGG - Intronic
990008110 5:50966052-50966074 GATGGAGGTGAAGGTGGGGATGG - Intergenic
990494219 5:56330960-56330982 GCTGCAGATTCAGATGTGGGAGG + Intergenic
993313132 5:86363135-86363157 GATGCAGAGTATGGTGTGGAAGG - Intergenic
993850023 5:92996351-92996373 GATGTAGGTTAATATTTGGGTGG + Intergenic
995150034 5:108832359-108832381 GATGCAGGTTAAGATGTGGATGG + Intronic
996909676 5:128640843-128640865 GATGAACGTTAACATGGGGAAGG + Intronic
997989698 5:138533927-138533949 GAGGCATGTTAGGAGGTGGATGG + Intronic
998170940 5:139871652-139871674 GATGCTGGGTCAGAAGTGGAGGG - Intronic
1001444101 5:171770012-171770034 AATCGTGGTTAAGATGTGGAGGG - Intergenic
1001865643 5:175102806-175102828 GAAGCATGTGAACATGTGGATGG + Intergenic
1004800172 6:19137847-19137869 GATGCAGGTTATGATGGTGCTGG + Intergenic
1004869489 6:19890385-19890407 GAAGCAGTTTGAGATGAGGAGGG - Intergenic
1010287008 6:74090755-74090777 GATCCATGTGAAGATGTGTATGG + Intergenic
1012639222 6:101588361-101588383 GAGGCAGGTTGAGGTGTGCAGGG + Intronic
1013460176 6:110367112-110367134 GATGCAGGGTGGGATGTGGATGG + Intergenic
1013635206 6:112022612-112022634 GAAGCAGCTGGAGATGTGGAGGG - Intergenic
1014438940 6:121451532-121451554 TATATAGGGTAAGATGTGGATGG + Intergenic
1016576852 6:145578823-145578845 GATGAGGGTAAAGATTTGGAGGG - Intronic
1017556462 6:155576548-155576570 GATTCAGGATAAGATTTGGGTGG - Intergenic
1017741384 6:157409701-157409723 GATGAAGGTGAAGAAGAGGAAGG - Intronic
1017832915 6:158147930-158147952 GATGCAGGTTGAACTGTGAAAGG - Intronic
1017942599 6:159066189-159066211 GATGCAGGAGGAGCTGTGGAGGG + Intergenic
1018503885 6:164443202-164443224 GATGTTGGTAAAGATATGGATGG + Intergenic
1018592234 6:165439527-165439549 GATGCTAGTTGAGAGGTGGAGGG - Intronic
1018918671 6:168155241-168155263 CATGCAGGTTAAGGAGCGGAAGG - Intergenic
1018932660 6:168252014-168252036 GATGCAGGCTCTGATTTGGAAGG + Intergenic
1023556313 7:41426808-41426830 AATGGAGGTGAAGATGTGGCAGG - Intergenic
1023606599 7:41937064-41937086 GATTCAAGTTGAGATTTGGATGG - Intergenic
1029480248 7:100807932-100807954 GATGCAGTTTAGGAAGTGGACGG - Intronic
1029732315 7:102446619-102446641 GATGCAGGTGCTGATGAGGAGGG - Exonic
1033433920 7:141314996-141315018 GAAGAAGGCTCAGATGTGGATGG - Intronic
1033712857 7:143966810-143966832 GATGCAGGTGCAAATGGGGAGGG - Intergenic
1034272235 7:149808933-149808955 GCTGCAGGTGAAGCGGTGGAGGG + Intergenic
1034330561 7:150278606-150278628 GAGGCCGGTGGAGATGTGGATGG - Intronic
1034352804 7:150428310-150428332 GATGCAAGATAAACTGTGGATGG + Intergenic
1034667481 7:152831242-152831264 GAGGCTGGTGGAGATGTGGATGG + Intronic
1035423886 7:158754018-158754040 GATGCAGGAGAAGCTGTGTAAGG + Intronic
1036461398 8:8956504-8956526 GATGCATGGTACAATGTGGATGG - Intergenic
1037114813 8:15211569-15211591 GGTGCAGGTTAATATGTAGTCGG - Intronic
1040433343 8:47365416-47365438 GAGGCATGCTAAGATGTGCATGG - Intronic
1042451974 8:68957753-68957775 GATGCTGGTGAGGTTGTGGAGGG - Intergenic
1043810910 8:84738949-84738971 GAAACTGATTAAGATGTGGAAGG + Intronic
1044121587 8:88403633-88403655 GATGAAGGTTAACATGTGAGGGG - Intergenic
1047550857 8:125870962-125870984 GATGCTGATTGAGATGAGGAAGG + Intergenic
1049204516 8:141357492-141357514 GATGCAGGTGAGGAAGAGGATGG + Exonic
1049764183 8:144345746-144345768 GATGCAGGCAAAAATGTGGAGGG + Intergenic
1051723455 9:20064158-20064180 GATACATGTTAAAATATGGATGG + Intergenic
1052246086 9:26337038-26337060 GATGCTGGTTGAGAACTGGATGG - Intergenic
1055516510 9:77039207-77039229 GATGCCGGTGACGATGAGGAGGG + Intergenic
1055726351 9:79233757-79233779 GTTGGAGGTTAGGATGTGGTGGG + Intergenic
1057776126 9:98011336-98011358 GATGAAGATGAAGATGTAGAAGG + Exonic
1059054225 9:110961908-110961930 GATTCAGGATAAGATTTGGGTGG + Intronic
1059180551 9:112208676-112208698 GATACAGGTTAAACTGTAGAAGG - Intergenic
1061710551 9:132484540-132484562 GATCCATGTTACAATGTGGATGG - Intronic
1061763283 9:132865299-132865321 GATGCAGGTTAGTTTGTGCAAGG + Intronic
1062339674 9:136088412-136088434 GCTGCTGGGAAAGATGTGGACGG - Intronic
1062517968 9:136945545-136945567 GAAGCAGGTGAAGTTGTGGGGGG + Intronic
1203664123 Un_KI270754v1:10353-10375 GATGCTGGTTAAGAGGTGGAAGG + Intergenic
1185737037 X:2502044-2502066 GATTCTGGCTAAGATGGGGAGGG - Intronic
1187489893 X:19741252-19741274 GATTCAAGTTAAGATGGGGGAGG - Intronic
1188173559 X:26959508-26959530 GATGATGGGTCAGATGTGGATGG - Intergenic
1189644429 X:43111568-43111590 GATACAGGCTCAGATGAGGAAGG + Intergenic
1190047056 X:47120696-47120718 GATGCATGTTCAGAAGTGGATGG - Intergenic
1192176437 X:68888894-68888916 AGTGCAGGTGAAGATGGGGATGG + Intergenic
1193264693 X:79454519-79454541 GATGCTGGTGAGGATGTGGAGGG + Intergenic
1193942667 X:87695261-87695283 GATGCAGGTTGAGAGGAGGCTGG + Intergenic
1194939937 X:99997534-99997556 AAGGCAGGTTAATATGTGCAAGG + Intergenic
1197632839 X:128881935-128881957 GAAGCAGGATAAGATGTGAAGGG - Intergenic
1198490540 X:137135853-137135875 GAAGCAGGTGCCGATGTGGAAGG - Intergenic
1199947244 X:152679581-152679603 GATGGGGGTGAAGATGGGGATGG - Intergenic
1199962436 X:152788873-152788895 GATGGGGGTGAAGATGGGGATGG + Intergenic
1201858845 Y:18573289-18573311 GATACAGATGCAGATGTGGAAGG - Intronic
1201874477 Y:18747092-18747114 GATACAGATGCAGATGTGGAAGG + Intronic
1202168239 Y:22014954-22014976 GATGCAGACTCAGATGTGGAAGG + Intergenic
1202223122 Y:22571414-22571436 GATGCAGACTCAGATGTGGAAGG - Intergenic
1202319993 Y:23624246-23624268 GATGCAGACTCAGATGTGGAAGG + Intergenic
1202550775 Y:26045810-26045832 GATGCAGACTCAGATGTGGAAGG - Intergenic