ID: 995153754

View in Genome Browser
Species Human (GRCh38)
Location 5:108884718-108884740
Sequence CAGAAAGCAAAGATAGTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995153754 Original CRISPR CAGAAAGCAAAGATAGTACG TGG (reversed) Intronic
902594904 1:17502685-17502707 CAGAAAGGAAAGCAAGTACGAGG - Intergenic
904731846 1:32598821-32598843 AAGCAAGCAAAGATAATACTAGG + Intronic
905328569 1:37175882-37175904 CAGAAAGCCAAGATAGCCAGAGG - Intergenic
906909252 1:49928561-49928583 CAGAAAGAAAAGATTGGAAGAGG + Intronic
908490885 1:64643098-64643120 GAGAAACAAAAGATAGTAGGTGG - Intronic
910126238 1:83845645-83845667 CAGAAAGCAAACTTTGTACTAGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911026263 1:93438412-93438434 CAGAAAGCAACGTCAGTTCGAGG + Intergenic
911297653 1:96136942-96136964 CAGAAAGCAATGAGAATACTTGG + Intergenic
911618406 1:100038797-100038819 CAGAAAGCGAACGTACTACGGGG - Intronic
911994614 1:104749774-104749796 CAGAAAGAGAAGATAGTATAAGG - Intergenic
917309073 1:173658594-173658616 CAGATTGCAAATATAATACGTGG - Intronic
917482085 1:175421016-175421038 CAGAAAGCAGAGAAAGTAGAAGG - Intronic
917780347 1:178388662-178388684 CAGCATGCAAAGATAGTAAAAGG + Intronic
920098661 1:203502886-203502908 GAGAAAGCAAAGAGTGTAGGAGG - Intronic
921723348 1:218498012-218498034 CAGTAAGCAAAGACAGAATGAGG + Intergenic
922699251 1:227748911-227748933 CAGAAAGCAAAAATCGGACTTGG - Intronic
922946619 1:229521857-229521879 CAGAAAGAAAAGAAAATACTTGG - Intronic
924164615 1:241268668-241268690 CAGAGAGCAAGGATAACACGAGG - Intronic
924350968 1:243114330-243114352 TCGAAAGCAAAGAGAGTAGGAGG - Intergenic
1063337747 10:5232844-5232866 CAGAAAACAATGATAGTCCATGG + Intergenic
1063629674 10:7722090-7722112 AAGAAAGCACAGAGATTACGGGG + Intronic
1063977479 10:11428962-11428984 CATAAAGCAAAGAAAGCACTTGG + Intergenic
1065148729 10:22799948-22799970 CAGCAAGCAAAGAGAGAATGAGG - Intergenic
1068609888 10:59047468-59047490 CATTAAGCAAGGATAGTACCTGG + Intergenic
1070468516 10:76750856-76750878 CAGAAAGCAAAGAGAGAGTGGGG + Intergenic
1071095538 10:81969656-81969678 CAGAAAGCACATATAGTATCAGG + Intronic
1071319071 10:84434370-84434392 CAGAAAGCAAATATATAACAGGG - Intronic
1081815430 11:45937333-45937355 CAGAAACCAAAGAGAGAACGAGG + Intronic
1083292631 11:61698441-61698463 CAGAAACCAAAGTTAGCAGGGGG - Intronic
1086784812 11:90955126-90955148 CAAAAAGCAAAGAGAGCACAAGG + Intergenic
1086963176 11:93001016-93001038 CTGAAACCAAGGATAGTACCAGG - Intergenic
1088353981 11:108922292-108922314 AAGAAAGCAAAGAAAGCACGAGG + Intronic
1088997644 11:115015718-115015740 CTGAAAGCAAAGAAAGGATGGGG + Intergenic
1089826796 11:121284943-121284965 CTGAATGCAAAGATGGAACGAGG + Intergenic
1091411895 12:246355-246377 CATAAAGCAAAAATATTACCAGG + Intronic
1093098027 12:14994344-14994366 CAGAGAGCACAGATAGTCCATGG + Intergenic
1094552099 12:31462488-31462510 CAGAGAGGAGAGACAGTACGGGG - Intronic
1098195323 12:67994377-67994399 CAGAAAGGAAGGACAGTAGGTGG + Intergenic
1098210547 12:68160180-68160202 CAGAAAGCAAGGAAAGAATGCGG + Intergenic
1099272320 12:80526126-80526148 GAGAAAGCACAGATAGGATGGGG - Intronic
1099545773 12:83977908-83977930 CAGAAAGGAAAGGTTGTACAGGG + Intergenic
1100955079 12:99898676-99898698 AAGAAAGCAAAGATTGGAGGGGG + Intronic
1105028355 12:132865100-132865122 CAGCAAGCACAGACAGGACGCGG - Intronic
1105533632 13:21243511-21243533 CAGAAAGCAGAGATGGGAGGAGG + Intergenic
1107360499 13:39612436-39612458 CTTATAGCAAAGATAGAACGTGG - Intergenic
1108007822 13:45969835-45969857 CAGAAAGGAAAGAGAGTTCAAGG - Exonic
1108758825 13:53537716-53537738 CAGAAAGAAAAGAGAGAAGGGGG - Intergenic
1111638253 13:90932878-90932900 CTGAAACCATAGATAGTACCAGG + Intergenic
1111733345 13:92104397-92104419 CTGAAAGCAAAGAGAATACTGGG - Intronic
1111805514 13:93035880-93035902 CAGAAAGTAAATATAATATGTGG + Intergenic
1115467982 14:33737163-33737185 CAGATAGCAAAGAAAGTGTGAGG + Intronic
1119870497 14:78012676-78012698 CAGAAAGCAGAAACAGTATGAGG + Intergenic
1121161565 14:91746192-91746214 CAGAAAGGAAAGATCACACGTGG - Intronic
1121165811 14:91797131-91797153 AAGAAAGCAAAGAAAGAAAGAGG + Intronic
1126345759 15:47692370-47692392 AGGAAAGCAAAGAAAGTAAGTGG - Intronic
1126522905 15:49616835-49616857 CAGATTGCAAAGATAATAGGAGG - Intronic
1126624284 15:50671300-50671322 CAGAAAGACAAGATACTACATGG - Intronic
1131518239 15:93093813-93093835 CAGAGAGCAAAGAAAATACCAGG + Intergenic
1135177158 16:20240487-20240509 CAGAAACACAAGATAGTAAGTGG + Intergenic
1137813354 16:51374423-51374445 CAGAAAAAAAAGATATTACATGG + Intergenic
1138315735 16:56068465-56068487 CAGGAAGCAAAGAGAGAAAGAGG + Intergenic
1145209371 17:21002050-21002072 TAGAAGGCAAAGAAAATACGAGG + Exonic
1149322622 17:55497098-55497120 CACAAAGGAAAGATATTATGGGG - Intergenic
1149736000 17:58994282-58994304 CAGAAACCAAAGATAATAGAGGG - Intronic
1150696756 17:67412034-67412056 CATAAAAGAAAGATAGTAAGAGG - Intronic
1151097089 17:71510688-71510710 CAGAAAGAAGAGATAGTGCAAGG + Intergenic
1151125631 17:71841749-71841771 CAGGAAGAAAAGATAATAAGGGG + Intergenic
1153214951 18:2810800-2810822 CAGCAGGCAAAGAGAGAACGAGG + Intergenic
1154467940 18:14668120-14668142 CACAAAGAAAAGAAAGTAAGTGG - Intergenic
1155811639 18:30243694-30243716 CAGAAAGAAAAGATACAAAGAGG + Intergenic
1156119652 18:33826684-33826706 CAAAAAGCAAAGATATTTCTTGG + Intergenic
1156573853 18:38290215-38290237 CATAAACCAAAGATAGAAAGAGG + Intergenic
1157108577 18:44798414-44798436 CAGAAAGAAAAGATGGTCAGAGG - Intronic
1157364908 18:47055565-47055587 CACAAAGCAAAGGTAGCCCGAGG - Intronic
1162129267 19:8515464-8515486 CAGAAAGCGAATATGGTGCGCGG + Intergenic
1162905942 19:13824078-13824100 GAGAAAGGAGAGATAGTAGGGGG + Intronic
1164523227 19:28994854-28994876 CAGAAAGCACAGAAAGGAAGTGG + Intergenic
1166285883 19:41828018-41828040 CAGAAAGCACAGAGAGTGCTTGG - Intergenic
1167320674 19:48795725-48795747 CAGAAAGCCCAGATAGTCAGAGG + Intronic
1168310708 19:55458928-55458950 CAAAAAGAAAAAATAGTACAGGG - Intronic
927317039 2:21695836-21695858 CAGTGAGCAAAGGTAGTACCTGG + Intergenic
930255057 2:49081048-49081070 CAGAAGGCAGAGAAAGTAAGGGG - Intronic
931450544 2:62364399-62364421 CAGCAAGCAAAAAAAGTACCTGG - Intergenic
932854674 2:75220662-75220684 CAGCAGGCAAAGAGAGAACGAGG - Intergenic
933301134 2:80542707-80542729 CAGCAAGCAGGGATGGTACGGGG + Intronic
935782093 2:106517352-106517374 GAGAAATCAAAGATAGTTCGGGG - Intergenic
936472851 2:112814193-112814215 CAGAAAGCAAAGATAAGGAGGGG - Intergenic
936990761 2:118363417-118363439 CAGAAAGAGAAGATAGAAAGGGG - Intergenic
938509354 2:131924552-131924574 CAGATAGAAATAATAGTACGGGG - Intergenic
938653025 2:133403131-133403153 CAGACAGCAAAGAAAGTTCTAGG + Intronic
938816371 2:134908701-134908723 CAGAATCCCAAGATAGTACAGGG + Intergenic
940929162 2:159406489-159406511 AAGAAAGCAAGGATATTACATGG - Intronic
941194434 2:162430557-162430579 CAAAAAGCCAAGATAACACGTGG + Intronic
943284790 2:185983910-185983932 CAGAAAACAAAAATTGTACTTGG - Intergenic
945843468 2:214915570-214915592 AAGAAAGGAAAGAAAGTAAGAGG + Intergenic
945856830 2:215079175-215079197 CAGGAAGAAAAGATGGTATGAGG - Intronic
1169364529 20:4981153-4981175 CAGAGAGCAAAGATAGAGCAGGG - Intronic
1169733788 20:8814751-8814773 CAAAATGCAAAGAGAGTAAGAGG - Intronic
1169943657 20:10965327-10965349 CAGAAAGAAAGGAGAGTACAGGG - Intergenic
1172543588 20:35741900-35741922 GAGAAAGCTGAGATAATACGCGG + Intronic
1172643384 20:36455221-36455243 CAGAAGGCAAAGATGGTGGGGGG - Intronic
1173994930 20:47330600-47330622 CAGAAAGCAAAGAAACCAGGGGG + Intronic
1174634764 20:51989456-51989478 CAGAAATAAAAGTTAGTACTGGG - Intergenic
1175228424 20:57458906-57458928 CAGAAAGAAAAGTTAGCAAGAGG + Intergenic
1176806573 21:13489533-13489555 CAAAAAGAAAAGAAAGTAAGTGG + Intergenic
1178102458 21:29284498-29284520 AATAATGCAAAGATAGTAAGGGG - Intronic
1178333011 21:31717107-31717129 CATAAAGCAAAAAGAGTACTGGG + Intronic
1185305673 22:50114483-50114505 CAGAAACAAAAGATACCACGGGG - Exonic
949678011 3:6479808-6479830 CTGAAAGCAAAAATAGTAATTGG + Intergenic
949767503 3:7543381-7543403 CAGAAAGCAAAGATATAAGATGG + Intronic
951132067 3:19059084-19059106 CAGAAGGCAAAGATAGACAGGGG + Intergenic
951819696 3:26794411-26794433 CAGAAAGGAAAGATGGAAGGAGG + Intergenic
952588280 3:34919809-34919831 CAGGAAGCAAATAAAGTAAGAGG + Intergenic
953713809 3:45298279-45298301 GAGAAAGCAAAGACAGCAGGTGG + Intergenic
956704107 3:71984493-71984515 CAGAAAGCTAAGATATAAAGAGG - Intergenic
957157318 3:76561583-76561605 CAAAAGGCAAAGATAGAACAAGG + Intronic
957414717 3:79886409-79886431 CAGTAAGCAGAGATAGAAGGAGG - Intergenic
957646905 3:82941107-82941129 CAGTAAGCAAACACAGTAAGAGG - Intergenic
959442813 3:106399523-106399545 CAGATAGCAAAGATGGAACAAGG - Intergenic
964618082 3:158691457-158691479 CAGTAAGCAAAGTTAGTTCTTGG - Exonic
964677721 3:159302371-159302393 CGGAAAGTAAATATAGTACCTGG + Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
971740097 4:30508252-30508274 CAGAAAGCAAAAATAGTGAGTGG - Intergenic
973727448 4:53790366-53790388 CAGAAAGCAAAGGTAGGGAGAGG - Intronic
973756908 4:54083868-54083890 CAGAAAGCAAAGAGTGTGAGTGG - Intronic
974786081 4:66621016-66621038 AAGAAAGCAATGATAGTCCATGG + Intergenic
974971539 4:68835336-68835358 AGGAAGGCAAAGATAGTAGGTGG + Intergenic
975681796 4:76884852-76884874 AAGAAAGAAAAGAGAGTACTTGG + Intergenic
976208348 4:82642868-82642890 CAGAAAGAAAGGATGGGACGAGG - Intronic
976424511 4:84886115-84886137 CAGAAAGCAAACATTTTACATGG + Intronic
976687907 4:87836454-87836476 AAGAAAGAAATGATAGTATGGGG - Intronic
978433143 4:108654317-108654339 CAGAAAGCAAAGATAGAAATAGG + Intronic
980678478 4:136123564-136123586 CAGAAAGAAAAGCTATTACCTGG + Intergenic
983084560 4:163427267-163427289 CAGAAAGGAAAGAGAGAAAGAGG + Intergenic
983208539 4:164935396-164935418 CAGAAAGCAAAGATATTTCTAGG + Intergenic
984214354 4:176890051-176890073 CAGAAAGAAAAGAGATTAGGTGG - Intergenic
984815131 4:183829338-183829360 CAGAAAGAAAAGACAGAACGTGG + Intergenic
988697065 5:33632794-33632816 CATAAAGCAAAAATAGAAAGCGG + Intronic
991350611 5:65716988-65717010 AAGAAAGCCAAGAAAGTATGAGG + Intronic
991618317 5:68519005-68519027 GAGAAAGGAAAGATAGTAAGAGG + Intergenic
995153754 5:108884718-108884740 CAGAAAGCAAAGATAGTACGTGG - Intronic
995467650 5:112467065-112467087 CAGAAAGCAAAGATGGGACAAGG + Intergenic
998306008 5:141077955-141077977 CAGAAAGACAAGAAAGTCCGCGG + Intergenic
1000808193 5:165824188-165824210 GGGAAAGCAAAGATAGTGCTAGG - Intergenic
1003377454 6:5593032-5593054 CAGAAAGCAGAGATGGGAGGAGG - Intronic
1003427278 6:6006249-6006271 CTGAAAGCAAAGATATTCCAGGG - Intronic
1003659789 6:8049381-8049403 AAGAAAGGAAAGAAAGAACGTGG + Intronic
1003750953 6:9055379-9055401 CAGAAAGCAAAGAAGGCAGGTGG + Intergenic
1004709491 6:18155855-18155877 CAGAAAGGAAACATTGTAGGGGG - Intronic
1008250103 6:49229405-49229427 CAGAAAGGAAAGAAAGAAGGAGG - Intergenic
1008811883 6:55512131-55512153 CAGAAAGCTAAGATAATAAAAGG + Intronic
1014814860 6:125924413-125924435 CAGAAAGCAAAGTTAGTGTCTGG - Intronic
1015173064 6:130276148-130276170 CATAAACCAAAGAAAGTATGTGG + Intronic
1015786532 6:136924360-136924382 CAGAAAGCAAAGCAACTACGAGG + Exonic
1020495532 7:8847712-8847734 TAGAAAGTAAATATAGTATGTGG + Intergenic
1021317970 7:19173924-19173946 CAGGACTCAAAGATAGAACGTGG - Intergenic
1022227539 7:28379080-28379102 CAGAAAGCCATGAAAGTATGAGG - Intronic
1022885576 7:34639945-34639967 CAGAAAGCAAGGATGGTAATGGG - Intergenic
1023106445 7:36767677-36767699 CAGAAAGGAAAGATAGGAAATGG + Intergenic
1023172438 7:37402791-37402813 CAGAAATTAAAGATAATATGTGG - Intronic
1029220159 7:98982355-98982377 CAGAAAGCACAGATTGTTCTAGG + Intronic
1032849877 7:135784926-135784948 CAGAAGACAATGATAGTACAGGG + Intergenic
1032896887 7:136261354-136261376 CTGAATGCAAAGATGGAACGAGG - Intergenic
1033460097 7:141539032-141539054 CAGAAAGCAAAGGAAGTTCATGG + Intergenic
1034507869 7:151509351-151509373 CAGAAAGCAAGGAAAGTGTGTGG + Intronic
1035520074 8:268537-268559 CTAAAAGCAAAGATAATATGAGG - Intergenic
1037551237 8:19973877-19973899 TAGAAATCAAAGCTAGTAAGTGG + Intergenic
1037681291 8:21099776-21099798 AAGAGAGCAAAGATACTAAGAGG + Intergenic
1039384129 8:37116933-37116955 AAGAAAGCACTGATAGTCCGTGG + Intergenic
1046673922 8:117088141-117088163 CAGAAAGCCAAGAAAGAACTTGG + Intronic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1047647534 8:126884398-126884420 AAGAAAGCAAAGATAACACCTGG + Intergenic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1050078402 9:1889058-1889080 CAGAAAGCAGAGATAGGAGGTGG + Intergenic
1050901533 9:10954931-10954953 CAGAAAACAAAGAAAGTAGAAGG + Intergenic
1051915486 9:22201553-22201575 CATAAAGGAAAGAAAGTACATGG - Intergenic
1052683056 9:31719065-31719087 CAAAAAGAAAAGATAATACTTGG - Intergenic
1053164289 9:35833704-35833726 CAGAATGCACAGCTAGTAGGTGG - Intronic
1057262575 9:93593362-93593384 CAGAGAGCAAATGTAGTCCGAGG - Intronic
1059135795 9:111805006-111805028 ATGAAAGCAAAGATAGTATAGGG - Intergenic
1203780599 EBV:98580-98602 CAGAGAGCAATGAAATTACGTGG - Intergenic
1185918271 X:4060504-4060526 CACAAAGTAAAGATAGTATTAGG + Intergenic
1189841221 X:45080862-45080884 TGAAAAGCAAAGATAGTAAGAGG + Intronic
1191932221 X:66386707-66386729 CAGAAAGCAAAGTTTGTACCTGG + Intergenic
1193276048 X:79589638-79589660 CAGAAAGCAAAGCTAGTGGCTGG - Intergenic
1194624392 X:96212077-96212099 GGGAAAGCAAAGATAGTTTGTGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1199703554 X:150404382-150404404 CAGAAAGCTAAGAAAGCACAGGG + Intronic