ID: 995153922

View in Genome Browser
Species Human (GRCh38)
Location 5:108886850-108886872
Sequence CATTAAATGCAGACATTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995153922 Original CRISPR CATTAAATGCAGACATTGGT AGG Intronic
902551358 1:17221548-17221570 CATTAAATGGAGTGATTGGGTGG + Intronic
906126273 1:43428808-43428830 CATGAAATTCACAGATTGGTTGG - Intronic
907754358 1:57296138-57296160 GAGTAAATGCAGATATTGTTGGG + Intronic
908154787 1:61341637-61341659 CAAAAAATGCAAACATTAGTTGG - Intronic
909952687 1:81738224-81738246 CAAGAAAGGGAGACATTGGTTGG - Intronic
910921631 1:92354594-92354616 CATTAAATGCAAACATTAACAGG + Intronic
913596505 1:120383767-120383789 GATGAAATGCAGACATTCTTGGG + Intergenic
914090763 1:144495216-144495238 GATGAAATGCAGACATTCTTGGG - Intergenic
914307843 1:146438999-146439021 GATGAAATGCAGACATTCTTGGG + Intergenic
914594267 1:149134134-149134156 GATGAAATGCAGACATTCTTGGG - Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921474396 1:215589067-215589089 CATTTAATCCAGAAATTGTTTGG - Intronic
923369215 1:233294011-233294033 CATTAAATACAGAAACTGCTTGG - Intronic
924374671 1:243392775-243392797 CATTAAATGCAGGAATGGTTGGG + Intronic
1063591772 10:7401939-7401961 AATTAAAGACAGACATTCGTAGG - Intronic
1064559886 10:16585580-16585602 CTTTGAATGCAGACACTGGGAGG + Intergenic
1066574709 10:36812779-36812801 CACTAAATGGAGAAATTGTTTGG - Intergenic
1067013256 10:42734393-42734415 CAAAAAATACAAACATTGGTGGG + Intergenic
1067310576 10:45109701-45109723 CAAAAAATGCAAACATTAGTGGG - Intergenic
1067966152 10:50915143-50915165 CATGAGATGCAGACATTGCTTGG + Intergenic
1070007017 10:72434395-72434417 CATGAACTGCATAGATTGGTTGG - Intronic
1070118371 10:73551223-73551245 CATCATATGGAGACATTTGTAGG - Intronic
1070425160 10:76279955-76279977 CATTAAATGCAGAGGTTGATTGG - Intronic
1072599786 10:96914926-96914948 CCTTAAATCCAGACATCTGTTGG - Intronic
1074231574 10:111541760-111541782 ATTAAAATGCAGAGATTGGTAGG + Intergenic
1079063198 11:17267492-17267514 AATTAAATGCAGAAATTAGCCGG - Intronic
1080369732 11:31621384-31621406 CATTAAAATCAGTCATTGCTTGG - Intronic
1081144329 11:39542870-39542892 CATTACATGAAACCATTGGTGGG + Intergenic
1082089719 11:48079464-48079486 GAGTAAATGCAGACACTGGATGG + Intronic
1082990594 11:59204633-59204655 CATGAAAGGCAGACATTAATTGG - Intronic
1088163114 11:106898192-106898214 CATCAAATGCTGACAAGGGTAGG + Intronic
1088769301 11:113016968-113016990 CCTTTAATGCAAACATCGGTTGG - Intronic
1089855207 11:121537505-121537527 TATTAAATGCAGACATGGACAGG + Intronic
1091679252 12:2514842-2514864 CATTAAATGAATAAATTGTTAGG + Intronic
1095334660 12:41010790-41010812 CATTTAATGCACATATTGGAGGG - Intronic
1095381982 12:41605938-41605960 TATTAATTGCAGTCATTGTTGGG - Intergenic
1097395817 12:59073472-59073494 CTTTAAACGCATACTTTGGTAGG + Intergenic
1102807292 12:115793192-115793214 CATTAGCTGCAGTCTTTGGTAGG - Intergenic
1103070246 12:117935418-117935440 CATGAAATGAACACATTGGAGGG - Intronic
1103194414 12:119029818-119029840 GATTAAATGCAGACATGGCAGGG + Intronic
1103704318 12:122863055-122863077 CATTAAATGCAGACATGAATAGG - Intergenic
1106695644 13:32169841-32169863 TATTAAATCTTGACATTGGTAGG - Intronic
1108225191 13:48282201-48282223 CATTAAGTGCAGATAGAGGTGGG - Intergenic
1109310943 13:60692616-60692638 AATTAGATGCAGCCATTGATTGG + Intergenic
1111108674 13:83678342-83678364 CATTAAAGGCAGACCTGGGATGG + Intergenic
1111151614 13:84261192-84261214 CATTATATTAAGACATTGGCAGG + Intergenic
1111285147 13:86081361-86081383 TATTAAAAGCAGAGATTGTTGGG + Intergenic
1115230480 14:31154962-31154984 CAATGAATACAGAAATTGGTGGG + Intronic
1115830961 14:37340546-37340568 CAAAAAATGCAGAAATTAGTTGG + Intronic
1119106442 14:71929659-71929681 CAATAAATGCTAAAATTGGTGGG - Intergenic
1123826719 15:24089407-24089429 CATCAAATGCAGACATTTTGGGG + Intergenic
1125096000 15:35852465-35852487 CATAAAATGCAATCACTGGTTGG - Intergenic
1129758438 15:78112586-78112608 CATTAAGTGCTGCCATGGGTGGG + Intronic
1130041734 15:80410640-80410662 CAGTAAATGCAAGCATTGTTTGG - Intronic
1131866392 15:96715828-96715850 CATTAAAGGCAGTAAGTGGTAGG + Intergenic
1132459801 16:46426-46448 TATTAAATGTAAAGATTGGTGGG + Exonic
1132955336 16:2589249-2589271 CAAAAAATGCATACATTGGCTGG - Intronic
1135152625 16:20022209-20022231 AATAAAATGAAGAAATTGGTTGG - Intergenic
1138579787 16:57933248-57933270 CATCAAATGGAGACATTTGCAGG + Intronic
1140026036 16:71290926-71290948 CATTATATGCAGCCATTAATAGG + Intergenic
1141819878 16:86437972-86437994 CATTAAAAGGAGACCTTGGCTGG + Intergenic
1142542346 17:669990-670012 GATTAAATGCAGACATTTTTGGG - Intronic
1142882274 17:2890980-2891002 CATAAAAAGTAAACATTGGTCGG - Intronic
1150372617 17:64653607-64653629 CAAAAAATACAGAAATTGGTCGG - Intronic
1151451778 17:74202613-74202635 AATAAAATGTAGACATTTGTAGG + Intergenic
1153936594 18:9931696-9931718 AATTAAGTGCTGACATTTGTAGG - Intronic
1154150731 18:11904478-11904500 CAAAAAATGCAAAAATTGGTGGG - Intronic
1154375096 18:13802604-13802626 CATTAAAAGCTGACATTCCTAGG + Intergenic
1155274965 18:24178128-24178150 CATGAAATGCACTGATTGGTGGG + Exonic
1155565707 18:27131956-27131978 CATGAAAGGTATACATTGGTTGG - Intronic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1157267527 18:46240412-46240434 CATTAATTGTAGGTATTGGTAGG + Intronic
1158317137 18:56223690-56223712 CATAAAATGTAAACATTTGTTGG + Intergenic
1159837610 18:73357918-73357940 GATTAAATGCACACATAGGAAGG + Intergenic
1162316163 19:9939365-9939387 CATAAAAGGAGGACATTGGTTGG + Intergenic
1162591692 19:11596510-11596532 CATTAAATGCAAATATTGGCCGG + Intronic
1167937620 19:52920768-52920790 CATTAAAGAAAGACATTGTTTGG - Intergenic
1168484360 19:56748261-56748283 CATAAAATGCAGGCACTTGTAGG + Intergenic
925605204 2:5653128-5653150 GATGAAATGCAGACATTCTTGGG + Intergenic
929921556 2:46175521-46175543 CATAAAATGGGGACATTAGTAGG - Intronic
931952832 2:67384251-67384273 CATCAATTGCAGCCATAGGTTGG - Intergenic
936007191 2:108900227-108900249 CATTAAATGTAGTCATTGTTAGG - Intronic
939236672 2:139503223-139503245 AATTAAATGGAGACATAGGATGG - Intergenic
939869654 2:147512687-147512709 CATCAAATGCACCCATTTGTGGG + Intergenic
943698828 2:190967002-190967024 CATTAAAGGCAGAGACTGGGGGG + Intronic
945436773 2:209827849-209827871 CATTAAATGATGAAATTGCTGGG - Intronic
945552384 2:211236266-211236288 CATTTAGTGTAGAGATTGGTAGG + Intergenic
946906819 2:224425493-224425515 TATTAAATGCAGGCTGTGGTGGG + Intergenic
1169385012 20:5141338-5141360 CATTAGATGCACACATTGCATGG - Intronic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1173873389 20:46355400-46355422 CCCTACATGCTGACATTGGTGGG - Intronic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1179147571 21:38781869-38781891 CATGAAATAGAGACAGTGGTGGG + Intergenic
1181475245 22:23164075-23164097 CACTAAATGCAGCCTGTGGTCGG + Exonic
1183385575 22:37512311-37512333 CATAAAATGAAGTCATTGTTGGG + Intronic
949255093 3:2036350-2036372 CAGTATATGCAGACATTTCTAGG - Intergenic
949504703 3:4716164-4716186 GATTAAAAGCAGAGATTAGTAGG - Intronic
949680018 3:6502858-6502880 CATGAAATGCGTTCATTGGTGGG + Intergenic
950149491 3:10675693-10675715 CAGCAAATGCAGAGACTGGTGGG - Intronic
951172615 3:19559425-19559447 AAGTAAATGCAGAAAGTGGTGGG + Intergenic
951786547 3:26426006-26426028 CATTAAATAGAGACATTAATTGG + Intergenic
951869309 3:27342719-27342741 CACTAGATGCAGAAATTGTTAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
959615432 3:108342176-108342198 CATTAAAAGAAGACTTTAGTAGG - Intronic
960713935 3:120557775-120557797 CATGAAATGCAGAAATTAGGGGG + Intergenic
963806703 3:149729837-149729859 TCTTAAATGCAGCAATTGGTTGG + Intronic
964087716 3:152836658-152836680 CATTGAAAGCACACATTGCTGGG - Exonic
965119510 3:164534466-164534488 AATAACATGCAGACATTGGCTGG + Intergenic
967140180 3:186551124-186551146 TCTTACATGCAGACACTGGTAGG - Exonic
970052842 4:11935091-11935113 CATTACATGTCGATATTGGTGGG - Intergenic
972033068 4:34486945-34486967 CCTCAAATGCAGACATATGTTGG + Intergenic
973154555 4:46934533-46934555 AATTAAATGCCAACATTGGGAGG - Intronic
974208461 4:58738489-58738511 CTTCAAATGTAGACATTTGTAGG - Intergenic
974544539 4:63283666-63283688 CATAAAATGTAGACATTAGAGGG - Intergenic
975183876 4:71378555-71378577 CATTAAATCCAGACATTGTTTGG - Intronic
976709206 4:88051066-88051088 CACTAAATGTAGACAGTGCTAGG - Intronic
977802430 4:101252328-101252350 GACTAAATGAAGACTTTGGTAGG + Intronic
977981299 4:103325808-103325830 CATTGAATGCATTCATTGTTTGG + Intergenic
982404099 4:155001513-155001535 CATTTAATCCAAACATTGGAGGG - Intergenic
986124131 5:4869660-4869682 CATTAAGTGCACAGATTGCTGGG - Intergenic
989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG + Intronic
990073888 5:51818850-51818872 CATTAGAAACAGTCATTGGTGGG + Intergenic
992951753 5:81865207-81865229 CACTAAATGCAGACCTAGTTGGG + Intergenic
994289579 5:98012684-98012706 CACATAATGCAGACCTTGGTAGG - Intergenic
994450846 5:99940825-99940847 TATTGAATGCTGACATTGATGGG + Intergenic
995153922 5:108886850-108886872 CATTAAATGCAGACATTGGTAGG + Intronic
997209937 5:132071345-132071367 CATTCAAAGCACACTTTGGTGGG + Intergenic
997556399 5:134802946-134802968 CATTAAAGGCAGACAGAGTTTGG - Intronic
999608219 5:153339694-153339716 CATTAAGTGTACACATTGATTGG - Intergenic
999936850 5:156495878-156495900 CTTTAAAAAGAGACATTGGTGGG - Intronic
1000431592 5:161159012-161159034 TAGTAAATACAGCCATTGGTAGG - Intergenic
1002070827 5:176678177-176678199 CAGTGAATGCAGCCTTTGGTGGG + Intergenic
1003503812 6:6724188-6724210 CAGAAACTGAAGACATTGGTTGG - Intergenic
1004307045 6:14510416-14510438 CACTGAAGGCAGACAGTGGTTGG - Intergenic
1009669790 6:66732141-66732163 CATTAAACGTAGAAATTAGTTGG + Intergenic
1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG + Intergenic
1012088299 6:94857947-94857969 TGATAAATGCAAACATTGGTTGG - Intergenic
1012375413 6:98556080-98556102 CATTAAATACAGACTTTGTATGG + Intergenic
1013395081 6:109727940-109727962 AACTAAATGCAGATTTTGGTCGG + Intronic
1014512631 6:122343171-122343193 AAATAAATGCAGACATTTGATGG + Intergenic
1018628337 6:165801852-165801874 TATTTCATGCAGTCATTGGTAGG - Intronic
1020125247 7:5529806-5529828 CATAAAAGGCAAACACTGGTCGG + Intronic
1020538549 7:9431505-9431527 CATTACATGAAGATATTTGTCGG - Intergenic
1021129321 7:16892094-16892116 CAATAAATGGAAACATTAGTTGG - Intergenic
1021873607 7:25028130-25028152 CTTTGAATGCAGACATAGGGAGG - Intergenic
1024488141 7:49943871-49943893 CAGTAACTGAAGACACTGGTGGG - Intronic
1024529334 7:50378108-50378130 CAGGAAATGCAGATATTTGTGGG + Intronic
1024775912 7:52785293-52785315 CAGAAAATGCAAAGATTGGTTGG - Intergenic
1025119055 7:56284392-56284414 CATCAAATCCAGACATAGGTAGG + Intergenic
1028444719 7:90908445-90908467 GATGAAATGCAGACAATGATTGG + Intronic
1028658596 7:93239386-93239408 CATGAATTGGATACATTGGTGGG + Intronic
1030840351 7:114344413-114344435 CATTGTATGCCAACATTGGTTGG + Intronic
1031461564 7:122056486-122056508 CATTAACTTCAGACATTTTTAGG + Intronic
1032403429 7:131639316-131639338 CACGAAATGCAGACAGGGGTGGG - Intergenic
1035798113 8:2378297-2378319 CTTTAAATGTAGACATTTTTAGG - Intergenic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1038291141 8:26250990-26251012 CATAAAATTCAGCCATTGGAAGG - Intergenic
1040042442 8:42930022-42930044 GATTAACTGCAGTGATTGGTTGG + Intronic
1040741919 8:50586271-50586293 CATTAACTGCATATATTTGTTGG - Intronic
1040819993 8:51545956-51545978 CATTTAAATCAGACATGGGTGGG + Intronic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1046892064 8:119433098-119433120 TATTAAATGGAGACATTAGAAGG + Intergenic
1047104936 8:121721613-121721635 CTTTGGATGCAGACCTTGGTGGG - Intergenic
1048179973 8:132185471-132185493 CAGCAAATGCAGACATGGGCTGG - Intronic
1048223517 8:132564319-132564341 GATTAAATGCAGACAGGGTTTGG + Intergenic
1049318444 8:141982399-141982421 CAATCAATGCAGACTATGGTTGG - Intergenic
1050592808 9:7177687-7177709 CATTACATGAAGTAATTGGTTGG + Intergenic
1050838578 9:10116508-10116530 CATTGAATACACACATTGTTAGG + Intronic
1052664764 9:31481401-31481423 CATTCACTGGAGACATTTGTTGG + Intergenic
1055204047 9:73705892-73705914 CATAAAATGCAGCCATTTATAGG - Intergenic
1058129419 9:101233179-101233201 AATTAAATGCAGCCATCTGTTGG - Intronic
1060566339 9:124595748-124595770 CATGAAATGGAGACATGGGAAGG - Intronic
1061508107 9:131043775-131043797 CGATGAATGCTGACATTGGTGGG + Intronic
1187549935 X:20292333-20292355 AATCAAATGCAGACATGGATGGG - Intergenic
1187659454 X:21524424-21524446 CATTAACTGATGACATTGATAGG + Intronic
1188949065 X:36346082-36346104 CTTTAAATGTAGACATTCATAGG + Intronic
1194198463 X:90925993-90926015 CATTAAATGCACAAATTTATAGG - Intergenic
1196723582 X:118876742-118876764 CATCAAAAGCAGATATGGGTGGG - Intergenic
1199820571 X:151441744-151441766 CACTAAATGCACATATTGGAAGG - Intergenic
1200543276 Y:4486835-4486857 CATTAAATGCACAAATTTATAGG + Intergenic
1201501050 Y:14643102-14643124 CATTGGATATAGACATTGGTTGG - Intronic
1202073803 Y:21018364-21018386 CATGAAATCAAGACATTTGTGGG - Intergenic
1202078503 Y:21060218-21060240 CATGAAATCAAGACATTTGTGGG - Intergenic