ID: 995154392

View in Genome Browser
Species Human (GRCh38)
Location 5:108893501-108893523
Sequence TCCCAAGACCTCCTACTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995154392_995154393 -5 Left 995154392 5:108893501-108893523 CCTAGAAGTAGGAGGTCTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 995154393 5:108893519-108893541 TGGGATGTAGTTTTATAATCTGG No data
995154392_995154395 18 Left 995154392 5:108893501-108893523 CCTAGAAGTAGGAGGTCTTGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 995154395 5:108893542-108893564 CCAAAATGTCTCTCAGAAGCAGG 0: 1
1: 0
2: 0
3: 31
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995154392 Original CRISPR TCCCAAGACCTCCTACTTCT AGG (reversed) Intronic
901278527 1:8012587-8012609 TACCAAGGCCTCATACTTCCAGG - Exonic
901798711 1:11694783-11694805 TCCCACAACCTTCTTCTTCTTGG - Intronic
902448763 1:16484001-16484023 GCCCAAGCACCCCTACTTCTGGG + Intergenic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
906746718 1:48226850-48226872 CACCAAGGCCTCCTACTTCAGGG - Intronic
908128796 1:61054252-61054274 TCCCGAGACCTCCTGCGTCCGGG - Intronic
909548299 1:76870749-76870771 TCCAAAGACCTTCTTCTACTAGG - Intronic
914095112 1:144538686-144538708 CCCCAGGAGCTCCAACTTCTGGG - Intergenic
914303412 1:146395217-146395239 CCCCAGGAGCTCCAACTTCTGGG + Intergenic
914516334 1:148377962-148377984 CCCCAGGAACTCCAACTTCTGGG - Intergenic
915597508 1:156904001-156904023 TCCCAATACCTGCAGCTTCTGGG + Exonic
916321814 1:163512924-163512946 TCCCCATACCTACCACTTCTGGG - Intergenic
916813219 1:168324572-168324594 GCCCTAGACTTCTTACTTCTGGG + Intergenic
917635604 1:176932782-176932804 TACCAAGAGCTCCTAGTTCTAGG - Intronic
917910423 1:179638886-179638908 TCCCAAGCTCTCCTGCATCTAGG - Intronic
918710576 1:187723211-187723233 TCCCAAAACATATTACTTCTTGG + Intergenic
918861945 1:189839366-189839388 TTCCAAGACCACATAATTCTAGG + Intergenic
920655475 1:207871157-207871179 TCACAAGGCCTCCTAGATCTGGG + Intergenic
923045365 1:230351653-230351675 GCCCACGACCTCCTTCTTCCAGG + Intronic
1064494557 10:15895341-15895363 TCCCAAGAAGTGCTCCTTCTTGG - Intergenic
1067668263 10:48296876-48296898 GCCCAAGCCCTCCTGCTTCGAGG + Intergenic
1069550875 10:69363134-69363156 TCCTAAGACAGCCTTCTTCTGGG + Intronic
1071577270 10:86737966-86737988 ACCCAAGCCCACCTACTTCACGG + Intergenic
1071909728 10:90217790-90217812 TCCCAAGCACTACCACTTCTTGG - Intergenic
1071953295 10:90729105-90729127 CTCCATGACCTCCTACTACTGGG - Intergenic
1072724038 10:97800618-97800640 TCCCAAGGCCTCCTGGTCCTGGG - Intergenic
1078021055 11:7656219-7656241 TCCCAAGGCCTTTTAGTTCTTGG + Intronic
1083031780 11:59599066-59599088 GCCCTGGACCACCTACTTCTGGG + Intronic
1084417327 11:69040515-69040537 CCCCAAGGACTCCTACCTCTTGG + Intergenic
1086948532 11:92867702-92867724 TTCCAAGATCTCCTATTCCTGGG - Intronic
1089266551 11:117267312-117267334 ACCCAAGATCACCTTCTTCTTGG + Intronic
1089491286 11:118885763-118885785 TCCCAAGAAAACCTACATCTGGG + Intronic
1089648163 11:119893882-119893904 TCCCCCGATCTCCTGCTTCTAGG + Intergenic
1089814187 11:121157978-121158000 CACCAAGACCTCCTACTGCCTGG + Exonic
1089875931 11:121722452-121722474 TCCCACCACCCCCTGCTTCTCGG + Intergenic
1093191202 12:16077278-16077300 CACCAAGACCTTCAACTTCTTGG + Intergenic
1095786177 12:46110744-46110766 CCTCAAGGACTCCTACTTCTAGG + Intergenic
1096001385 12:48133474-48133496 TCCCAAGTCCCCTTACCTCTGGG - Exonic
1099459103 12:82901378-82901400 CACCACGACCTCCGACTTCTGGG + Intronic
1102037727 12:109781797-109781819 TCCCATGGCCTCCTAGCTCTGGG - Intergenic
1102461438 12:113102113-113102135 TCCTCAAACCTACTACTTCTAGG + Intronic
1104561753 12:129852145-129852167 TCCTAATACCTGTTACTTCTAGG + Intronic
1106432973 13:29699210-29699232 TCTCAGGGACTCCTACTTCTAGG + Intergenic
1107388850 13:39942514-39942536 TCCCAAGACATCCCAGTCCTGGG + Intergenic
1107943373 13:45394570-45394592 CCCCAAGAACTTCCACTTCTGGG - Exonic
1110211599 13:72980062-72980084 TCCCCAAACCTCTTTCTTCTAGG - Intronic
1111767376 13:92548740-92548762 TTCCCAGAACTCCTATTTCTTGG + Intronic
1114196984 14:20487058-20487080 CTCCAAGGCATCCTACTTCTTGG - Intergenic
1114365907 14:22026898-22026920 TCTCAGGGACTCCTACTTCTAGG + Intergenic
1114403584 14:22432857-22432879 GCCAAAGACCTCATATTTCTTGG + Intergenic
1114416685 14:22549563-22549585 ACCCCAGACCTCCTAGTTCTTGG - Intergenic
1115674795 14:35660571-35660593 TCCAAAGCAATCCTACTTCTGGG + Intronic
1116786105 14:49290470-49290492 TCCCAATTCTTCCCACTTCTTGG - Intergenic
1116821048 14:49628378-49628400 TACCAAGACCTCTTTCTTTTAGG - Intronic
1121050275 14:90815816-90815838 CCCCATCACCTCCAACTTCTTGG + Intronic
1122904682 14:104796184-104796206 TCCCAAGACCTTGTGCCTCTGGG + Intergenic
1124693658 15:31845869-31845891 TCCCCAGACCTCCTCCTGCATGG - Intronic
1128601292 15:68997513-68997535 TCCCAAGGCCTGATAGTTCTTGG + Intronic
1129387792 15:75205400-75205422 TCCCAAGATCCCCTCCTTCTTGG - Intronic
1132162445 15:99555798-99555820 CCCCAAGAGCTCCTACTGGTAGG - Intergenic
1135263417 16:21000557-21000579 TGCCAAGACCTCCAGCTTCCTGG - Intronic
1139356048 16:66367501-66367523 GGCCCAGACCTCCTGCTTCTGGG - Intronic
1140870963 16:79106135-79106157 TCCCCAGACCTACTGCGTCTGGG + Intronic
1141629636 16:85280202-85280224 TCCCAAAACCTCCGACTCCTGGG - Intergenic
1142074358 16:88108789-88108811 CCCCAAGACCTCCTGCTCCAGGG + Intronic
1142195570 16:88737859-88737881 TCTCAGGACCTCCTGCCTCTGGG - Intronic
1142417997 16:89953626-89953648 TCCCAAGATCCCCTGCTCCTGGG + Intronic
1144276339 17:13672090-13672112 TCCCAGGGACTCCCACTTCTAGG + Intergenic
1146157355 17:30535498-30535520 TCCCAGGAGCTCCTATCTCTGGG - Intergenic
1146590665 17:34125734-34125756 TCCCACAACCTACTACTTGTGGG - Intronic
1149305560 17:55343462-55343484 TCCTCAGACCTCCTCCTTCTGGG - Intergenic
1150498187 17:65625374-65625396 CCCCAAGACCTTCCCCTTCTTGG + Intronic
1150572813 17:66402573-66402595 TCCCAACACCTCAGACTTGTTGG - Intronic
1150883331 17:69056913-69056935 TTCCAAGTCTTCCTACCTCTTGG - Intronic
1151057778 17:71053397-71053419 TTCCAAGAGCTTCCACTTCTTGG - Intergenic
1152063742 17:78098476-78098498 TCCCAAGCCCTCCTCCACCTGGG + Exonic
1153981243 18:10312462-10312484 TCCCAAGGTCTGCTTCTTCTAGG + Intergenic
1155179888 18:23335345-23335367 TCCCAAGAGCTGCTTCATCTAGG + Intronic
1157302301 18:46487849-46487871 ACCCAAGACTTCCAAGTTCTGGG + Intronic
1157392831 18:47317286-47317308 TCTCAAATCCTCCTATTTCTTGG + Intergenic
1158652815 18:59302735-59302757 TTTCAAGACTTACTACTTCTTGG + Intronic
1162059405 19:8085744-8085766 TCCCCAGATCTCCCACTTCTGGG - Intronic
1163621508 19:18363598-18363620 TCCTAAGACCTCATCCTGCTGGG + Exonic
1163695538 19:18761596-18761618 TCCCAAAAGCTCCTTCTTCCAGG - Intronic
1164122437 19:22278856-22278878 TACCAAGACATCCCACTGCTAGG + Intergenic
1166813732 19:45529044-45529066 CCCCGAGACCTCCTATTTCTCGG + Exonic
926465586 2:13182302-13182324 TGCCAACATCTCTTACTTCTTGG + Intergenic
927002987 2:18818382-18818404 TCAAAATACCTCCTAGTTCTTGG - Intergenic
930844943 2:55893319-55893341 TCCCCTGAACTCCTAATTCTTGG - Intronic
932619176 2:73255776-73255798 TCCCAAGGCCTGCTACTCCAAGG - Exonic
936453103 2:112647963-112647985 TCCCAGTTTCTCCTACTTCTTGG - Intronic
936879403 2:117232140-117232162 TGTCAAGAACTCCTACTTTTAGG - Intergenic
937080446 2:119136471-119136493 TCCCAGGCCCTCCTCCTTCCAGG + Intergenic
937987367 2:127644060-127644082 CCCCAGGACCTGCTACTGCTGGG + Intronic
940195894 2:151093747-151093769 TCCCAAGACCTCCTTCAGGTGGG - Intergenic
945276414 2:207991828-207991850 CCCCAAGACCACCTACCCCTGGG + Intronic
1169155193 20:3323703-3323725 TCCCAAGGCCTCCTAGGCCTAGG - Intronic
1170263520 20:14439871-14439893 TCCCATGACTTCCTGCCTCTGGG - Intronic
1171435513 20:25119930-25119952 TCCCATGTCTTCCTCCTTCTTGG - Intergenic
1175679632 20:60976600-60976622 CCCCAACCCATCCTACTTCTTGG - Intergenic
1176254309 20:64143022-64143044 TCCCAAATCCTACTGCTTCTAGG + Intergenic
1179451096 21:41468951-41468973 TCCCTAGGCCGCCTGCTTCTCGG + Intronic
1181557177 22:23677897-23677919 TCCCCAGACCTCCTACCACCAGG + Intergenic
1181818235 22:25455880-25455902 TCCCAGGACCTCCTGCTCCAAGG - Intergenic
1183477381 22:38042979-38043001 CCCCAAGGCTTCCTTCTTCTGGG - Intergenic
1184404164 22:44290733-44290755 TACCTAGACCTCCTACTTCATGG + Intronic
949159164 3:859651-859673 CCACAAGACCACCTCCTTCTTGG + Intergenic
951955825 3:28252204-28252226 TCCCAATAGCACCTATTTCTTGG - Intronic
954749279 3:52804560-52804582 TTCCAAGAACTCCTAGTTCCAGG + Intronic
956921963 3:73939353-73939375 ACCCAACACCTCCCACTTGTGGG - Intergenic
958741911 3:98084204-98084226 TCCCAAACCTTACTACTTCTTGG + Intergenic
959659537 3:108850625-108850647 TCCCAACTCCTACTACATCTTGG - Intronic
960957719 3:123045967-123045989 TGCCAAGACCACCTGCTCCTTGG + Intergenic
964692015 3:159460715-159460737 TCCCAAGACCCCCTTAGTCTTGG + Intronic
967104026 3:186241137-186241159 TAAAAAGACCTCCTTCTTCTTGG + Intronic
968624836 4:1622448-1622470 TCCCATGACCTCCTTCCACTGGG + Intronic
968849161 4:3066580-3066602 TTCCAAGTCATCCTTCTTCTTGG - Intergenic
969542396 4:7801145-7801167 TCCCAGGGCCTCCTATTTCTTGG - Intronic
971721902 4:30255778-30255800 TCTCAGGGACTCCTACTTCTAGG - Intergenic
973691548 4:53438253-53438275 TCCCAACACCTCCATCTTCCTGG - Intronic
975491493 4:74994104-74994126 TCACACGAATTCCTACTTCTTGG - Intronic
976907931 4:90263224-90263246 TCTCAGGAACTCCTACTACTAGG - Intronic
979725105 4:123951860-123951882 TTCCAAGACCACTTACATCTGGG - Intergenic
979927251 4:126582924-126582946 GCCCAAGAGCTCCCACTTGTGGG + Intergenic
980534095 4:134092464-134092486 TCCCATGACCTGATACTTCCTGG + Intergenic
980730873 4:136823404-136823426 TTCCCAGAGCTCCTACGTCTGGG + Intergenic
983177626 4:164610156-164610178 TCCCAATCCCTCCTACTGGTAGG + Intergenic
985070156 4:186159652-186159674 ACCCAAGAGCTCCTACTACAGGG + Intronic
988292538 5:29307761-29307783 TGCCAAGACTTCCTATTTTTTGG - Intergenic
990457466 5:56001910-56001932 TGCTATGACCTCCTGCTTCTTGG + Intergenic
991656108 5:68905311-68905333 TCCCAAGCCCTCCTTTTGCTGGG - Intergenic
993705301 5:91162709-91162731 AGCCAAGCCCTCCTTCTTCTGGG - Intronic
993851600 5:93016974-93016996 TTCCAAGGCCTTCTATTTCTGGG + Intergenic
995154392 5:108893501-108893523 TCCCAAGACCTCCTACTTCTAGG - Intronic
1001092192 5:168749722-168749744 TCCTGAGACCTCCTCCTTCCTGG - Intronic
1002523731 5:179804857-179804879 TCCAAAGACCTGGTACTACTGGG + Intronic
1002846418 6:949091-949113 TCCCATGCCCTCATACTGCTGGG - Intergenic
1006081920 6:31572788-31572810 ACCCTACACCTCCTCCTTCTGGG + Exonic
1008103476 6:47417724-47417746 TGCCAAGACTTGCTACTTTTAGG + Intergenic
1008358143 6:50580231-50580253 TCCCATCTCCTCCTAGTTCTTGG + Intergenic
1008628235 6:53338447-53338469 TCCCAGGACCTCATGTTTCTAGG - Intronic
1008632207 6:53372830-53372852 TCCCAAATCCACCTACTGCTTGG + Intergenic
1010397021 6:75404354-75404376 TCCCAAGATCTCTTCCTGCTGGG + Intronic
1012847980 6:104413634-104413656 CCCAAAGCCCTCCTCCTTCTGGG + Intergenic
1013376357 6:109518957-109518979 TCCCCAACCCTCCTCCTTCTAGG + Intronic
1016560576 6:145391805-145391827 TCCCAAGATCTCCCACTTTTAGG + Intergenic
1020806995 7:12802340-12802362 TCCCATGTCCTCCTGCTTCCTGG + Intergenic
1020997426 7:15281048-15281070 TCTCAGGGCCTCCTACTCCTAGG + Intronic
1022056943 7:26746711-26746733 TCCAAAGCCCTCCTAATTCCAGG + Intronic
1022851813 7:34271029-34271051 TTCGAAGTCCTCCTACATCTTGG - Intergenic
1023835262 7:44064037-44064059 GCCCCAGACCTCCTGCTCCTAGG - Intronic
1025094075 7:56084165-56084187 TCCCAAGTCCACCAACTTCAGGG - Exonic
1026955764 7:74375755-74375777 TCCCATGACCTCCACCTGCTGGG + Intronic
1027586481 7:80064942-80064964 TACCAAGACCTCCTCCTCCCAGG - Intergenic
1028248871 7:88515974-88515996 TCCCAAGCCCACCTTCTTCCTGG + Intergenic
1029524815 7:101088115-101088137 CCCCAGCACCTCCTGCTTCTGGG - Exonic
1030079487 7:105765010-105765032 TGGCAAGAACTCCTACTTCAAGG - Intronic
1032477680 7:132223550-132223572 CCCCAAGACCTGCTCCTTCCAGG - Exonic
1033509907 7:142049923-142049945 TCCCATGAAATCCCACTTCTGGG + Intronic
1033512701 7:142075912-142075934 TCCCATGAATTCCCACTTCTGGG + Intronic
1034549732 7:151812910-151812932 TCTCAAGGCCTACTACTGCTGGG + Intronic
1039334354 8:36573681-36573703 TCCCAGGACCTCCAGCTTGTAGG + Intergenic
1041986884 8:63932243-63932265 TCTCAAGACCTCCCTCTTCAAGG + Intergenic
1043491595 8:80754662-80754684 TCACAAGGCCTCCTCCTTCCAGG + Intronic
1045664399 8:104469445-104469467 TCCCAAGACTTCTTATTTTTAGG + Intergenic
1047010013 8:120662509-120662531 ACCCAAAACTTTCTACTTCTTGG + Intronic
1047608475 8:126497561-126497583 TACCAACACCTGCCACTTCTGGG - Intergenic
1047940200 8:129822052-129822074 TCCCAAGCCCGCCATCTTCTTGG - Intergenic
1051668415 9:19486728-19486750 TCTCCAGACCTCTTCCTTCTTGG + Intergenic
1052660179 9:31419411-31419433 TCACATGACCTCATTCTTCTTGG + Intergenic
1053106787 9:35416367-35416389 TCTCAGGGACTCCTACTTCTAGG + Intergenic
1056001684 9:82224076-82224098 TCCCCAAACCTCCTAGTTCTAGG - Intergenic
1056082207 9:83107139-83107161 GCCAATGACCTCCTACTTCATGG + Intergenic
1057200214 9:93135657-93135679 TGCCAAGCCCTCCTACTTCGGGG - Intergenic
1058806731 9:108600045-108600067 ACCCAAGACCTCCTTTTTCCAGG + Intergenic
1058873022 9:109218707-109218729 TCCCGATGCCTCTTACTTCTTGG + Intronic
1060566204 9:124594146-124594168 TTCCAAAACCTCCTACAACTGGG + Intronic
1061055922 9:128222893-128222915 GTCCCAGACCCCCTACTTCTGGG - Intronic
1186737193 X:12478185-12478207 TCCAGAGACCTCCTTCTTCCTGG - Intronic
1189450829 X:41128584-41128606 TTCCAAGACCTCTTACCACTTGG + Intronic
1191931651 X:66380030-66380052 TGCGAAGACCTTCTCCTTCTAGG + Intergenic
1193300925 X:79887428-79887450 TCTCAGGAACTCCTACTCCTAGG + Intergenic
1194384524 X:93236721-93236743 TCTCAGGAACTCCTACTTTTAGG + Intergenic
1194959383 X:100217529-100217551 TCTCAAGAACTCCTTCTGCTGGG + Intergenic
1194981440 X:100445213-100445235 TCCCAAGGGCTCTTCCTTCTTGG - Intergenic
1199170250 X:144726777-144726799 TCTCAGGGACTCCTACTTCTAGG + Intergenic
1199298522 X:146186352-146186374 TCTCAGAAACTCCTACTTCTAGG - Intergenic
1200121866 X:153794876-153794898 TCCCAAGGCCGCCTGCCTCTCGG - Intronic