ID: 995154736

View in Genome Browser
Species Human (GRCh38)
Location 5:108897225-108897247
Sequence ATAAAATCAAGGTGACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 713
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 613}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995154736_995154738 -8 Left 995154736 5:108897225-108897247 CCAGACTGTCACCTTGATTTTAT 0: 1
1: 0
2: 5
3: 94
4: 613
Right 995154738 5:108897240-108897262 GATTTTATTTATTTTACCCTAGG 0: 1
1: 0
2: 4
3: 54
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995154736 Original CRISPR ATAAAATCAAGGTGACAGTC TGG (reversed) Intronic
901558560 1:10051163-10051185 ATAAAATCCAGGTAAGAGCCAGG - Intronic
901748708 1:11392360-11392382 ACAACATCAAGGTGGCAGTGGGG + Intergenic
901754137 1:11430749-11430771 CCAAAATCAAGGTGTCAGTGAGG + Intergenic
902247402 1:15129856-15129878 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
902726658 1:18340676-18340698 CTGAAATCAAGGTGTCAGTAGGG + Intronic
902744328 1:18463408-18463430 CTAAAATCAAAGTGCCAGTAGGG + Intergenic
903037956 1:20506924-20506946 ATAAAATCAAGATGAAAATGTGG + Intronic
903455920 1:23486635-23486657 CTAAAATCAAGGTATCAGTGGGG + Intergenic
904203771 1:28839157-28839179 CCAAAATCAAGGTGACAGCAGGG + Intronic
905082000 1:35331488-35331510 ATAAAATTGTGGTGTCAGTCAGG + Intronic
905470733 1:38189806-38189828 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
907116474 1:51972747-51972769 CTAAGATCAAGGTGCCAGTAGGG - Intronic
907990719 1:59579711-59579733 GTAAAAACAGGGAGACAGTCAGG - Intronic
908806635 1:67938911-67938933 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
909063230 1:70903240-70903262 CTAAAATTAAGGTGACAGTGGGG - Intronic
909239563 1:73195176-73195198 ATTCAATCAAGGTGCCAGCCAGG + Intergenic
909363795 1:74796458-74796480 CTAAAATCAAGGTGTCAGAAGGG - Intergenic
909381340 1:75002373-75002395 TTAAAATCAAGGTGTCAGCAGGG + Intergenic
909677434 1:78253731-78253753 CTGAAATCAAGGTGTCAGCCTGG + Intergenic
910401085 1:86838799-86838821 ATAAAATAAATGTGAAAGCCAGG + Intergenic
910418980 1:87035165-87035187 CTAAAATCAAGGTGTCAGCTAGG - Intronic
910462327 1:87460885-87460907 ACAAAATCAAGGTGCCAGCAAGG - Intergenic
910789866 1:91039889-91039911 ATCCAATCAAGTTGACATTCAGG - Intergenic
912540934 1:110414796-110414818 CCAAAATCAAGGTGTCAGTGAGG - Intergenic
914348490 1:146819981-146820003 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
915806598 1:158859878-158859900 ATAAAATCAAGATGAAATTCTGG + Intergenic
916574228 1:166052835-166052857 ATAAAATGGAGATGAAAGTCAGG - Intergenic
916822937 1:168417350-168417372 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
917129865 1:171730109-171730131 CTAAAATCAAGGTGCCAGTAGGG - Intronic
917134648 1:171777925-171777947 TTAAAATCAAGGTGTCAATAGGG + Intergenic
917701516 1:177586331-177586353 ATAAAATCAAAGTGACAGAGGGG - Intergenic
918529450 1:185502122-185502144 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
918729331 1:187971211-187971233 ATAAAATCAAGATGTCAGCCGGG - Intergenic
919355963 1:196521974-196521996 ATAAAATAAAGATGAATGTCAGG + Intronic
919788141 1:201273273-201273295 CCAAAATCAAGGTGTCAGCCTGG + Intergenic
920142409 1:203827382-203827404 ATAAAAGTAAGGTGACTGGCCGG + Intronic
920818549 1:209358324-209358346 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
921223073 1:212988015-212988037 ATAAAATCAAGGTGAATCTTAGG - Intronic
921421509 1:214954219-214954241 CTAAGATCAAGGTGTCAGTGGGG + Intergenic
922110729 1:222552626-222552648 ATAAGATTAAGGTAACAGTAAGG + Intergenic
922115788 1:222612550-222612572 AGAAAAGAAAGGTGACATTCTGG - Intergenic
922332169 1:224586948-224586970 CTAAAATCAAGGTGTCAGCAGGG - Intronic
922340287 1:224649367-224649389 CTAAAATCAAGGTGTCAGCAGGG - Intronic
922365592 1:224860502-224860524 ATCCAATCAAGTTGACACTCAGG + Intergenic
922512008 1:226176480-226176502 GTAAAATCAAGGTGTCAGCAGGG - Intronic
922679172 1:227576962-227576984 ATAAAATTAAGGTGGAAGTCAGG - Intronic
923073848 1:230591741-230591763 ATAAAATCAGGGTCACACTGGGG - Intergenic
923145716 1:231196305-231196327 TAAAAATCAGGGTCACAGTCTGG + Intronic
923629162 1:235638369-235638391 CTAAAATCAAGGTGCCAGGAGGG + Intronic
923751116 1:236746915-236746937 ATAAAGTCATGGTGCCATTCTGG + Intronic
923775449 1:236974315-236974337 CCAAAATCAAGGTGTCAGTAGGG - Intergenic
923970267 1:239194042-239194064 CCAAAATCAAGATGTCAGTCAGG - Intergenic
924238732 1:242021378-242021400 CTAAAATCAAGGTGTCAGTGGGG + Intergenic
924322066 1:242860323-242860345 TTAAAATCAAGGTGTCGGTAGGG - Intergenic
924464156 1:244285031-244285053 ACAAAAGCAAGGTGTCAGCCAGG + Intergenic
1062836906 10:641551-641573 AGAAAATCAAGCTGACACCCGGG - Intronic
1063643652 10:7856629-7856651 ATAAATTCAAGGCAACAATCTGG - Intronic
1063740346 10:8811256-8811278 ATAAAATCAAGATGTTAGCCTGG + Intergenic
1064000050 10:11656111-11656133 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
1064000208 10:11657560-11657582 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
1064681131 10:17811880-17811902 ATAAAATAAAAGTTACAGGCTGG - Intronic
1064813649 10:19231463-19231485 TTACAATCAAGGTGAGATTCAGG - Intronic
1065634543 10:27717193-27717215 ATGACATCAAGGTGTCATTCTGG - Intronic
1065847551 10:29758661-29758683 ATAAAGTCAAGGTGTCAGGCCGG + Intergenic
1067179579 10:43974443-43974465 CTAAAATCAAGATGTCAGTGGGG - Intergenic
1067950767 10:50736554-50736576 CTAAAATCAAGGTGTCAATTGGG + Intergenic
1068028166 10:51674718-51674740 ATTAAATCGAGGTGACAATTTGG + Intronic
1068265127 10:54638038-54638060 AGAAAATCACGGTGTCTGTCTGG - Intronic
1068272301 10:54744262-54744284 CTAAAATCAAGGTGTCAATTGGG - Intronic
1068415544 10:56716848-56716870 TTAAAATCAAGGTGTCAGCAAGG + Intergenic
1068525043 10:58118538-58118560 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1068607053 10:59017243-59017265 TTAAAATCAAGGTGTCAGCAGGG + Intergenic
1068649584 10:59507203-59507225 CTAAAGTCAAGGTGTCAGCCAGG + Intergenic
1069206937 10:65701369-65701391 ATGAAACCAAGGTGTCAGCCAGG + Intergenic
1069880882 10:71592431-71592453 TTAAAATCAAGGTGTCAGCAGGG + Intronic
1070362054 10:75700031-75700053 CTGAAATCAAGGTGACAGCAGGG - Intronic
1070713509 10:78700747-78700769 CTGAAATCAAGGTGTCAGCCAGG - Intergenic
1070747504 10:78943399-78943421 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1070816352 10:79327040-79327062 AGAAAATCAGGGTTACTGTCAGG + Intergenic
1070886112 10:79901763-79901785 CTAAAATCAAGGTGTCAGTTGGG + Intergenic
1072300600 10:94057794-94057816 CTAAAATCAAGGTGTCAGCTGGG + Intronic
1072527338 10:96285047-96285069 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1073309949 10:102533273-102533295 TCAAAATCAAGGTGCCAGGCTGG + Intronic
1073986688 10:109217617-109217639 ATAAAAGTAAGGTGGCAGACAGG + Intergenic
1074207531 10:111296972-111296994 ATTAAATCAAGGGCACTGTCAGG + Intergenic
1074688954 10:115986228-115986250 CTAAAATCAAAGTGTCAGCCAGG - Intergenic
1075125826 10:119698128-119698150 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1076414350 10:130274728-130274750 ATAAAATGAAGGAGAGAGTTTGG - Intergenic
1078120742 11:8506469-8506491 CTAAAATCAAGGTGTCAGCGGGG + Intronic
1078415311 11:11160094-11160116 CTAAAATCAAGGTGTCTGTGGGG + Intergenic
1078930578 11:15909433-15909455 ATAAAATCAAGCTGTCAGCAGGG - Intergenic
1079662691 11:23060331-23060353 TTAAAGTCAAGATGACAGACAGG - Intergenic
1079860136 11:25658970-25658992 CTAAAATCAAGGTGTCAGGTGGG - Intergenic
1079870061 11:25786238-25786260 CTAAAATAAAGGTGTCAATCAGG + Intergenic
1080048618 11:27835919-27835941 TTAAAATCAAGGTAACAGCCAGG + Intergenic
1080091893 11:28358252-28358274 GTAAAATCAAGGTGTCAGCCAGG - Intergenic
1080114388 11:28605933-28605955 ATGAAATCAAGGTGTTAATCAGG + Intergenic
1080228414 11:29987117-29987139 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1080391862 11:31855404-31855426 CTGAAATCAAGGTGTCAGTAAGG - Intronic
1080403862 11:31961224-31961246 CTAAAATCAAGGTGTCGGCCGGG + Intronic
1080688284 11:34534091-34534113 CCAAAGTCAAGGTGTCAGTCTGG - Intergenic
1080769894 11:35330845-35330867 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1084583000 11:70036138-70036160 CCAAAATCAAGGTGCCAATCAGG + Intergenic
1084636135 11:70394132-70394154 CTAAAGTCAAGGTGTCAGTGGGG - Intergenic
1085841688 11:80018586-80018608 ATGAAATCAAGGTGCCAGCAGGG + Intergenic
1086255664 11:84873375-84873397 ATAAAATCAAGGTGCCAGCAGGG - Intronic
1086594425 11:88554110-88554132 TTAAAATCATGGTGTCAGTAGGG + Intronic
1087008486 11:93491824-93491846 ATAAAAACATGGGGACAGGCTGG - Intronic
1087157770 11:94921686-94921708 ATAAAATCAAGGTGTCAGCAGGG + Intergenic
1087255882 11:95952480-95952502 ATAAAAGAAAGGTGACAAACAGG + Intergenic
1088165205 11:106927075-106927097 ATAAAATCAAGATTAGAGGCCGG + Intronic
1088400266 11:109416008-109416030 ATGAAATCAAGATGAAAGCCAGG + Intergenic
1088572503 11:111236708-111236730 CTAAAATCAAGGTGTCAGCTGGG + Intergenic
1088831840 11:113543532-113543554 CTGAAATCAAGGTGTCAGTTGGG + Intergenic
1090563322 11:127957991-127958013 CTAAAATCAAGGTGTCAATAGGG + Intergenic
1090602253 11:128385436-128385458 ATACAATCAAGCTGACACTCAGG + Intergenic
1090987231 11:131779235-131779257 CTGAAATCAAGGTGTCAGCCAGG - Intronic
1091177729 11:133576690-133576712 ATCAAGTCAAGGTCACAGTGGGG + Intergenic
1092649165 12:10614125-10614147 AAAAAAGCACGGTGACTGTCAGG - Intergenic
1092695475 12:11166810-11166832 CTAAAATCAAGGTGTCAGCAAGG + Intronic
1092845339 12:12579778-12579800 ATAAAATCAAGGTGTCAGCAGGG + Intergenic
1093496382 12:19762848-19762870 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
1093505421 12:19859608-19859630 ATAACATCAAGGTGTCAGCAGGG + Intergenic
1093656673 12:21702390-21702412 CTGAAATCAAGGTGTCAGCCAGG - Intronic
1094340506 12:29406281-29406303 ATAAAATAAAGGTGACTTCCTGG - Intergenic
1095342500 12:41108138-41108160 CTGAAATCAAGGTGTCAGTCAGG + Intergenic
1095721307 12:45404486-45404508 CTAAAATCAAGGTGTTAGTGGGG + Intronic
1095779790 12:46047031-46047053 ATAAGATCAAGGTGCCAGCAGGG - Intergenic
1096943116 12:55371559-55371581 CTGAAATCAAGGTGACAGCAGGG + Intergenic
1097449122 12:59714423-59714445 TCAAAATCAAGGTGCCAGTAGGG + Intronic
1097632393 12:62079992-62080014 CTAAAATCAAGGGGTCAGCCAGG + Intronic
1098097933 12:66979910-66979932 CCAAAATCAAGGTGACAGCAGGG - Intergenic
1098999004 12:77154969-77154991 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1099298518 12:80861618-80861640 ATTAAGACAAGGAGACAGTCAGG - Intronic
1099595115 12:84652792-84652814 CTAAAATCAAGATGTCAGTGAGG + Intergenic
1099631403 12:85150133-85150155 ATAAAATCAGTGTAAGAGTCAGG + Intronic
1099811413 12:87587211-87587233 ATAAAGTCAAGTTGTCAGTAGGG + Intergenic
1100276424 12:93075874-93075896 AGAAAATCAGGGTGTCAGTCTGG + Intergenic
1100385770 12:94103335-94103357 ATAAAATCAAGGTGTCAGCTGGG - Intergenic
1100673735 12:96844461-96844483 CTAAAGTCAAGGTGTCAGCCGGG - Intronic
1100714647 12:97293217-97293239 ATAAAATCAAGGTGTCAGCAGGG + Intergenic
1100969622 12:100053712-100053734 ATGATATCAAGGAGACAGTAAGG + Intronic
1101191228 12:102335548-102335570 CTAAAATCAAGGTGTCAGTAAGG + Intergenic
1101964862 12:109275527-109275549 CTAAAATCAAGGTGTCAGTGGGG + Intergenic
1102963357 12:117108033-117108055 TTAAGATCAAGGTGTCAGTGGGG - Intergenic
1103305014 12:119957100-119957122 CTAAAATCAAGGTGCCACTAGGG - Intergenic
1103307387 12:119976226-119976248 ATAGATTCAAGGTGAGAGTCAGG - Intergenic
1104101979 12:125621349-125621371 ATAAAAGCAAGGTGAATGTAAGG + Intronic
1104230152 12:126876861-126876883 ATAAAAACAAGGAGGCAGTTAGG + Intergenic
1105057469 12:133115723-133115745 ATAAAATCCAGGTGAGATGCTGG + Exonic
1106001096 13:25724128-25724150 GTAAAATCAAGGTATCAGCCAGG - Intronic
1106253773 13:28003258-28003280 ATAAAATGAAGGGGACTGTGGGG + Exonic
1106375681 13:29184886-29184908 AAAAAATCATGGTGGCAGTAGGG + Intronic
1106844190 13:33720082-33720104 CTAAACTCAAGGTGTCAGTAGGG + Intergenic
1107619091 13:42206587-42206609 CTAAAATCAAGGTGTCAGCTGGG + Intronic
1107691756 13:42960661-42960683 CTAAAATCAAGGTGCCAGAAAGG + Intronic
1107799352 13:44089719-44089741 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1108047453 13:46396655-46396677 CTAAAATCAAGGTGTCAGTGGGG - Intronic
1108199677 13:48030796-48030818 AGAAGATCAAGGTGACAGTAGGG + Intergenic
1108309424 13:49172476-49172498 ACAAAATCAAGGTGTCAGCATGG + Intronic
1109016697 13:57024857-57024879 ATAAAATCAAGGTAGCAAACAGG - Intergenic
1109134555 13:58630485-58630507 CTAAAATCAAGGTGTAAGCCAGG - Intergenic
1109445526 13:62434326-62434348 ATAAAATGAAGGTGCCCTTCAGG + Intergenic
1109960147 13:69618882-69618904 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
1109981489 13:69913817-69913839 ATCTAATCAAGCTGACACTCAGG - Intronic
1110274829 13:73631797-73631819 TTAAAATCAAGGTGTCAATGGGG - Intergenic
1110593646 13:77293859-77293881 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1110838332 13:80110619-80110641 CTAAAATCAAGGTGTTAGCCAGG - Intergenic
1111005696 13:82245303-82245325 CTAAAGTCAAGGTGTCAGTCGGG + Intergenic
1111353598 13:87066196-87066218 ATAAAATAAATGTGATAATCTGG + Intergenic
1111565980 13:90016668-90016690 ATCAAATTTAGCTGACAGTCAGG - Intergenic
1111724173 13:91983386-91983408 ACAACATCTAGGTGACAGTGTGG + Intronic
1111832927 13:93352876-93352898 ATAAAATCAAGAAGACAATTAGG + Intronic
1112090676 13:96079979-96080001 CTAAAATCAAGGTGTCAGCTGGG + Intergenic
1112287425 13:98116621-98116643 CCAAAATCAAGGTGTCAGTAGGG - Intergenic
1112378132 13:98862871-98862893 CCAAAATCAAGGTGTCAGTGGGG - Intronic
1112419016 13:99230551-99230573 ATAAAATCAAGGTGTCAGCAGGG + Intronic
1114188832 14:20425329-20425351 ATATAGGCAAGGTAACAGTCTGG - Intergenic
1114699692 14:24664457-24664479 CCAAAATCAAGGTGTCAGCCAGG - Intergenic
1114790574 14:25653511-25653533 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
1114802403 14:25792365-25792387 ATAAATTGAGGGAGACAGTCGGG - Intergenic
1115162551 14:30412218-30412240 CTAAAATTAAGGTGTCAGTGAGG + Intergenic
1116028978 14:39548095-39548117 ATAAAATCAAGCTGTCATCCAGG - Intergenic
1116229245 14:42194768-42194790 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1116231400 14:42222470-42222492 ATAAAATCAAAGTGTCAGCATGG - Intergenic
1116548094 14:46197276-46197298 CTGAAATCAAGGTGTCAGGCAGG + Intergenic
1116557642 14:46333129-46333151 ATAATATCAAGGTGTCAGTTAGG + Intergenic
1116994817 14:51312025-51312047 ATAAACTGAAGGTGACAGGAAGG - Intergenic
1117799824 14:59431686-59431708 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1118519153 14:66561828-66561850 CTAAAATCAAGGTGTCAATAGGG + Intronic
1119165328 14:72487725-72487747 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1119684732 14:76622633-76622655 CCAAAATCAAGGTGTCAGTAGGG + Intergenic
1119689586 14:76661078-76661100 ATGAAGTCAAGGTGTCAGTAGGG + Intergenic
1120838512 14:89062486-89062508 CTAAAATCAAGGTGTCAGTGGGG - Intergenic
1120998326 14:90433792-90433814 TTAAGATCAAGGTGTCAGTAGGG + Intergenic
1121182522 14:91940191-91940213 ATAGAATTAAGGTGTCAGTAGGG - Intronic
1121251760 14:92505040-92505062 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1121660150 14:95628958-95628980 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1121855453 14:97265524-97265546 TTAAGATCAAGGTGCCAGTGCGG + Intergenic
1123539673 15:21275594-21275616 TTAAAATCAAGGTGACAGCAGGG + Intergenic
1125326056 15:38537081-38537103 AAAAAATCATGGTTCCAGTCTGG - Intronic
1125772367 15:42177961-42177983 GTAGAATTAAGGTGAGAGTCCGG - Intronic
1126038311 15:44567610-44567632 GAAAAAGCAAGGTGTCAGTCAGG + Intronic
1127989982 15:64106836-64106858 CTAAAATCAAGGTGTCAGTAGGG - Intronic
1128828373 15:70742970-70742992 CCAAAATCAAGGTGCCAGCCAGG + Intronic
1129074623 15:72982794-72982816 AAAAAATCAAGGTGTCAGTAGGG + Intergenic
1130797452 15:87224935-87224957 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1130959654 15:88651403-88651425 CTAAAATCAAAGTGTCAGTGGGG + Intronic
1131337045 15:91559086-91559108 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
1131510347 15:93046383-93046405 ATAAAATCAAGGTATCAGCAGGG - Intronic
1131999023 15:98161601-98161623 AAAAAAAAAAGGTGGCAGTCAGG + Intergenic
1202947982 15_KI270727v1_random:2756-2778 TTAAAATCAAGGTGACAGCAGGG + Intergenic
1132666740 16:1084439-1084461 ATAAAGCCAAGGTGTCAGCCAGG - Intergenic
1133498313 16:6341160-6341182 CTAAAATCAAGGTGTCAATGGGG + Intronic
1133626592 16:7575622-7575644 CTAAAATCAAGGTGCCAGGAGGG - Intronic
1133904049 16:10004525-10004547 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1133904852 16:10012808-10012830 CTAAAATCAAGGTGTTAGTAGGG - Intronic
1133979184 16:10620878-10620900 AAAAAATCAAGGTGAAGGCCGGG + Intergenic
1134180178 16:12041532-12041554 CTAAAGTCAAGGTGACAGCAGGG + Intronic
1134283275 16:12837019-12837041 CTAAAATCAAGGTGTTAGTAGGG - Intergenic
1134564624 16:15240534-15240556 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1134929630 16:18195995-18196017 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1135306927 16:21375282-21375304 CTAAAGTCAAGGTGACAGCAGGG + Intergenic
1135320804 16:21494907-21494929 ATAAATGCAAGGAGAAAGTCAGG - Intergenic
1135373639 16:21926397-21926419 ATAAATGCAAGGAGAAAGTCAGG - Intergenic
1135438148 16:22444305-22444327 ATAAATGCAAGGAGAAAGTCAGG + Intergenic
1136303669 16:29354423-29354445 CTAAAGTCAAGGTGACAGCAGGG + Intergenic
1136720898 16:32318978-32319000 CTAAAATCAAGGTGCCAGCGGGG - Intergenic
1137999506 16:53260662-53260684 ATAAAATCAAGGTGTCAGTAGGG + Intronic
1138909046 16:61374466-61374488 CTGAAATCAAGGTGTCAGTAGGG + Intergenic
1139287272 16:65826852-65826874 CTAAAATCAAGGTGTCAGAAGGG + Intergenic
1139985545 16:70895567-70895589 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1140495787 16:75387097-75387119 AGAACATGAAGGTGAAAGTCAGG + Intronic
1140740168 16:77934509-77934531 CTAAAATCAAGGTGTCAGCTGGG - Intronic
1140755895 16:78066380-78066402 CTAAAATCAAGGTGTCAGTGAGG + Intronic
1140889579 16:79273507-79273529 CTAAAATCAAGGTGTCTGCCAGG + Intergenic
1141222099 16:82080544-82080566 ATAAAATCAAGGAGTCAGCAGGG - Intronic
1141563858 16:84888112-84888134 CTAAAATCAAGGTGGCAGCAGGG + Intronic
1142218974 16:88843691-88843713 GCAAAATCAAGGTGTCAGCCGGG - Intronic
1203005534 16_KI270728v1_random:198792-198814 CTAAAATCAAGGTGCCAGCGGGG + Intergenic
1203137084 16_KI270728v1_random:1734913-1734935 CTAAAATCAAGGTGCCAGCGGGG + Intergenic
1143098619 17:4492192-4492214 ATTAAAACAAGATGACAGGCTGG + Intergenic
1144047820 17:11469409-11469431 CTAAAATCAAGGTGATACTGGGG - Intronic
1144127875 17:12219873-12219895 CCAAAATCAAGGTGTCAGTGGGG - Intergenic
1146959892 17:36965218-36965240 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1147268067 17:39246844-39246866 ATAAACCCAAGGAGACATTCTGG - Intergenic
1147676616 17:42210903-42210925 TTCAAATCAAGGTGATAGCCGGG + Intronic
1149028802 17:52061396-52061418 CTAAAATCAAGGTGTCACTAGGG - Intronic
1149317271 17:55450265-55450287 ATGAAATCAAGGTGTCAGAGGGG - Intergenic
1149462142 17:56837691-56837713 ATAAAATCCAGAGGACTGTCTGG - Intronic
1150669657 17:67181462-67181484 ATAAAATCCAGGTGGGAATCAGG - Intronic
1151222703 17:72624921-72624943 TTAAAACCAAGGTGTCAGTGGGG + Intergenic
1152323054 17:79619336-79619358 TTGAAATCAAGGTGTCAGTGGGG + Intergenic
1152373486 17:79905257-79905279 ATAAAATCAAGGTATCAGCAGGG + Intergenic
1152815614 17:82405966-82405988 ATAAAAACAAGGAGCCAGCCGGG + Intronic
1153038169 18:784562-784584 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1153705324 18:7738944-7738966 AAAAAATCATGGTCACTGTCTGG - Intronic
1153940555 18:9973073-9973095 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
1153987399 18:10365417-10365439 TTGAAATCAAAGTGACAGTCAGG - Intergenic
1154100503 18:11468675-11468697 CTGCAATCAAGGTGTCAGTCTGG + Intergenic
1155364753 18:25038847-25038869 CTAAAATCAAGGTGTCAGCTGGG + Intergenic
1155437377 18:25827275-25827297 CCAAAATCAAGGTGTCAGTAGGG + Intergenic
1156982842 18:43311514-43311536 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
1157085419 18:44575534-44575556 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1157314362 18:46575683-46575705 CCAAAATCAAGGTGTCAGCCAGG - Intronic
1157495239 18:48152333-48152355 AAAAAATCCAGGTGAAAGGCAGG + Intronic
1157925310 18:51758489-51758511 ATAAAATCAATTTGAGAGACTGG - Intergenic
1158214050 18:55080715-55080737 CCAAAATCAAGGTGACGGTAGGG + Intergenic
1158749583 18:60243478-60243500 AGAAAAACAAGGAGACAGTAAGG - Intergenic
1159173888 18:64809888-64809910 CCAAAATCCAGGTGTCAGTCGGG - Intergenic
1160373939 18:78396679-78396701 AGAAAACCAAGGTGAGAGGCTGG + Intergenic
1164501991 19:28827922-28827944 CTAAAATCAAGGTGCCAGCTGGG + Intergenic
1165362058 19:35342779-35342801 ATAAAAACAAGGAGCCTGTCAGG - Intronic
1165520957 19:36313455-36313477 TTTAAATCAAGGTGACAGGCTGG + Intergenic
1165623116 19:37265131-37265153 TTTAAATCAAGGTGACAGGCTGG - Intergenic
1165643926 19:37417208-37417230 CTAAAATCAAGGTGTCAGTGGGG - Intronic
1166145107 19:40828799-40828821 ATAAAGTCAAGGTGTCAGCAGGG + Intronic
1167348429 19:48961144-48961166 ATCAAGTCAAGGTCACAGTGAGG - Exonic
1167538314 19:50069487-50069509 CTAAAACCAAGGTGACAGCTCGG - Intergenic
1168192294 19:54748030-54748052 CTAAAATCAAGGTGACAGCAAGG + Intronic
1168196618 19:54779307-54779329 CTAAAATCAAGGTGACAGCAAGG + Intronic
1168200197 19:54809529-54809551 CTAAAATCAAGGTGACAGCAAGG + Intronic
1168202397 19:54825722-54825744 CTAAAATCAAGGTGACAGCAAGG + Intronic
1168207202 19:54859773-54859795 CTAAAATCAAGGTGACAGCAAGG + Intronic
1168517940 19:57024067-57024089 AGAAAATCAAGGTGGTAGCCTGG + Intergenic
925670343 2:6304057-6304079 TTAAGATCAAGGTGTCAGCCGGG + Intergenic
926814203 2:16784289-16784311 CTAAAATCAAGGTGTCAGCATGG - Intergenic
926832265 2:16976571-16976593 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
927206463 2:20614240-20614262 CTAAAATCAAGGTGTTAGTAGGG - Intronic
927225457 2:20760807-20760829 ATATGATAAAGGTGACAGACAGG - Intronic
927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG + Intergenic
928041959 2:27887334-27887356 CTAAAATCAAGGTGTCAGCAGGG - Intronic
928224841 2:29439854-29439876 TCAAAATCAAGGTGTCAGCCAGG - Intronic
928309651 2:30198801-30198823 ATAAAATTAAGGTGTCAGCAGGG - Intergenic
928416416 2:31095945-31095967 CTAAAATCAAGGTGTCAGCAAGG + Intronic
929378150 2:41316163-41316185 ACAATATCAAAGTGACAGTTGGG + Intergenic
929449323 2:42026118-42026140 TGCAGATCAAGGTGACAGTCCGG - Intergenic
929639601 2:43564314-43564336 TCAAAATCAAGGTGTCAGTAGGG + Intronic
930412195 2:51039046-51039068 CTAAAATCAAGGTGTCAGCCAGG - Intergenic
930424675 2:51197431-51197453 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
931047766 2:58375846-58375868 CTGAAATCAAGGTGACAGCCAGG + Intergenic
931214248 2:60226529-60226551 ATGAAATCAAGGTGTCAGCAGGG + Intergenic
931303098 2:61000475-61000497 TTAAAATCAAGGTGCCAGCAGGG + Intronic
931465973 2:62487161-62487183 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
931562787 2:63580917-63580939 AAAAAATCAAGGGGATAGTGTGG + Intronic
931782187 2:65588392-65588414 CTAAAATTAAGGTGTCAGTGGGG + Intergenic
933117177 2:78489105-78489127 ATATAATCAAGGACTCAGTCAGG - Intergenic
933561532 2:83893165-83893187 ATAAAATCAAGGTGTCAGCAGGG + Intergenic
934040210 2:88122114-88122136 CTAAGATCAAGGTGACAGCAGGG + Intergenic
935012106 2:99145062-99145084 CTAAAATCAAGATGTCAGGCAGG + Intronic
935307969 2:101756238-101756260 TTAAGATCAAGGTGTCAGCCGGG - Intronic
935445456 2:103151621-103151643 CTAACATCAAGGTGATAGTTGGG - Intergenic
935691535 2:105736367-105736389 CTAAAATCAAGGTGGCAGTGGGG - Intergenic
935861856 2:107339768-107339790 TTAAAATCAAGGTGTCAGCCGGG - Intergenic
936562857 2:113556865-113556887 TCAAAATCAAGGTGTCAGTGGGG - Intergenic
936648660 2:114401186-114401208 CTAAAATTAAGGTGTCAGTACGG - Intergenic
936745905 2:115576032-115576054 ATAAAATAAAGATGACAGTGAGG - Intronic
936974446 2:118205164-118205186 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
936982221 2:118275533-118275555 CTAAAATCAAGGTGCCAGCAGGG + Intergenic
937470630 2:122171140-122171162 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
937898866 2:127000759-127000781 CTGAAATCAAGGTGACAGCAGGG + Intergenic
938619076 2:133030804-133030826 CCAAAATCAAGGTGTCAGTAGGG + Intronic
938624653 2:133095036-133095058 CTGAAATCAAGGTGCCAGCCAGG - Intronic
939863592 2:147446958-147446980 ATAACAACAATGTGACAGTCAGG - Intergenic
940180155 2:150923150-150923172 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
940404553 2:153285292-153285314 TTACAATCAAGGTGAGAGTTGGG + Intergenic
940480319 2:154220899-154220921 AAAACAAAAAGGTGACAGTCTGG - Intronic
940711805 2:157171148-157171170 ATAAAATCAAGGAGAAAGTGAGG - Intergenic
940882279 2:158958632-158958654 ATACAATCAAGGTGAATTTCAGG + Intergenic
941396873 2:164984108-164984130 CTAAAATCAAGGTGACAGTAGGG + Intergenic
941483243 2:166044820-166044842 ATAACACCAAGTTGACAGTCAGG - Intronic
941647404 2:168056315-168056337 ACAAAATCAAGGTGAGCTTCCGG + Intronic
941805713 2:169710251-169710273 CTATAATCAAGGTGTCAGCCTGG - Intronic
941865640 2:170331637-170331659 CTAAAATCAAGGTGTCAGTAGGG + Intronic
941953819 2:171184233-171184255 CTAAAATCAAGGTGTCAGCAGGG - Intronic
942413026 2:175731454-175731476 CCAAGATCAAGGTGACAGTAGGG - Intergenic
942633935 2:177981346-177981368 CTAAAATCAAGGTGTCAGAAGGG + Intronic
942945730 2:181670620-181670642 TTAAAATCAAGGTGTCAGCAGGG + Intronic
943158887 2:184220584-184220606 ATAAACTCAAGGTGAAAGGGTGG - Intergenic
943255079 2:185584278-185584300 TTAAAATCAAGCTGAAATTCTGG + Intergenic
943263216 2:185693052-185693074 CTAAAATCAAGTTGTCATTCAGG - Intergenic
943365832 2:186966860-186966882 GTAAAATGAGGGTGACAGGCCGG + Intergenic
944342117 2:198613618-198613640 AGAAATTCAAAGTGACAGACCGG + Intergenic
944546094 2:200800225-200800247 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
944908900 2:204290121-204290143 ATAAACTTAAGGTGACAATTTGG + Intergenic
945224447 2:207519240-207519262 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
945518779 2:210797210-210797232 ACAAAAACAAAGTGACATTCTGG - Intergenic
945781568 2:214180596-214180618 ATAAAAACAAGGTAGCATTCAGG + Intronic
946062679 2:216957909-216957931 CTAAAATCAAGGTGTCAGTAGGG + Intergenic
946068159 2:217007881-217007903 ACAAAATCAAGGTGAGATTTGGG + Intergenic
946150960 2:217770211-217770233 TTAAAATCAAGGTGCCAGCAGGG + Intergenic
946481780 2:220063988-220064010 CTGAAATCAAGGTGTCAGTGGGG + Intergenic
946855806 2:223948597-223948619 ATAGAAGCAAGGTGTCAGTCAGG + Intergenic
946974439 2:225132350-225132372 TTGAAATCAAGGTGTCAGTGGGG + Intergenic
947338022 2:229107197-229107219 CTGAAATCAAGGTGACAGCAGGG - Intronic
948026599 2:234782926-234782948 CTAAAATCAAGGTGTCGGCCCGG - Intergenic
948050526 2:234976315-234976337 AATAAATAAAGGTGACAGCCTGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1169401892 20:5289039-5289061 ATAAAATCAAGGTGTCCGCAGGG + Intergenic
1170879498 20:20283616-20283638 CTAAAATCAAGGTGCCAATCAGG + Intronic
1172001976 20:31785791-31785813 TTAAAAGCAAGGTGCCAGCCAGG - Intronic
1173203014 20:40967844-40967866 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1173472628 20:43335627-43335649 CCAAAATCAAGGTGTCAGGCAGG + Intergenic
1173915714 20:46707521-46707543 TTGAAATCAAGGTGTCAGCCAGG + Intergenic
1174705347 20:52649671-52649693 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1174865948 20:54135794-54135816 CTAAAATCAAGGTGTCAGTAGGG + Intergenic
1175214831 20:57386572-57386594 CTAAAATCAAGGTGGCAGCAAGG + Intergenic
1177278104 21:18942193-18942215 CTAAAATAAAGGTGACAGTGAGG + Intergenic
1177628983 21:23702102-23702124 CTGAAATCAAAGTGTCAGTCCGG + Intergenic
1177682432 21:24389994-24390016 GTAAAATCAAGGTGTTGGTCAGG + Intergenic
1177943905 21:27443981-27444003 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1179260470 21:39753843-39753865 ATAAACTCAAGGTGAAAGGTTGG - Intronic
1179515721 21:41905054-41905076 ATAAAATTAAAGTGACGGTGAGG + Intronic
1181483040 22:23213119-23213141 AGACAAGCAAGGAGACAGTCAGG - Intronic
1181797689 22:25321708-25321730 CTAAAATCAGGGTGCCAGCCAGG + Intergenic
1182112734 22:27734807-27734829 ACAACTTCAAGGGGACAGTCTGG + Intergenic
1182509537 22:30809149-30809171 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1183762505 22:39835703-39835725 CTAAAATCAAGGTGTCCGTAGGG - Intronic
1183810896 22:40256325-40256347 ACAAAATCAATGTGACAATAGGG - Intronic
1184009452 22:41736033-41736055 ATGAAATCAAGGTGTCAGCAGGG + Intronic
1184364380 22:44040646-44040668 CTAAAATCAAGGTGTCAGCAGGG - Intronic
949107834 3:222209-222231 CTAAAATCAAGGTGGCAGCAGGG + Intronic
949113692 3:294020-294042 TTAAAATAAAGGTTACAGGCTGG + Intronic
949518565 3:4828856-4828878 CATAAATCAAGGTGTCAGTCTGG - Intronic
950144221 3:10636263-10636285 AGAAATGCAAGGTGACAGTAGGG + Intronic
950358251 3:12429757-12429779 ATTAAACCAAGGTGCCAGTCTGG + Intronic
951190345 3:19761576-19761598 ATGAAATCAAGGTATCAGACAGG - Intergenic
952082161 3:29772204-29772226 CTAAAATCAAGGTGTCAGCAAGG - Intronic
952229443 3:31414664-31414686 AAGAAAGCAAGCTGACAGTCTGG - Intergenic
952357086 3:32594478-32594500 AAAAAATCAAGGTGAAATTAGGG - Intergenic
953294269 3:41697006-41697028 CTAAAATGAAGGTGTCAGTATGG - Intronic
953446419 3:42972402-42972424 CCAAAATCAAGGTGACAGCAGGG + Intronic
953531605 3:43744937-43744959 CTAAAATCAAGGTGCCAGCAAGG + Intergenic
954623747 3:52010860-52010882 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
955212172 3:56952400-56952422 CTGAAATCAAGCTGTCAGTCAGG - Intronic
955633081 3:60995565-60995587 ATAACATCCAGGTCACGGTCTGG - Intronic
956193565 3:66630267-66630289 CTATAATCAAGATGTCAGTCAGG - Intergenic
956323840 3:68028546-68028568 ATGAAATCAAGGTGTCAGCAGGG + Intronic
956401327 3:68883140-68883162 CTAAAATCAAGGTGTCAGCTGGG + Intronic
956561468 3:70580882-70580904 TTAAAATCAAGGTGTCAGCAGGG - Intergenic
957013014 3:75029447-75029469 CCAAAATGAAGGTGTCAGTCAGG + Intergenic
957017925 3:75091512-75091534 AACAATTCAAGGTGACATTCCGG + Intergenic
957351074 3:79022398-79022420 ATAAAAACAAAGTGCCATTCAGG + Intronic
957424856 3:80024352-80024374 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
957470223 3:80649588-80649610 CTAAAGTCAAGGTGTCAGTAAGG + Intergenic
957586076 3:82133712-82133734 CTAAAATCAAGGTGTCAATGGGG + Intergenic
958271497 3:91505224-91505246 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
961496273 3:127294118-127294140 CTAAAATCAAGGTATCAGTGAGG + Intergenic
962024216 3:131529843-131529865 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
962577716 3:136770090-136770112 ATAAGATCAGAGAGACAGTCGGG + Intergenic
962782094 3:138728982-138729004 ACAAAATCAAGATGGCAGGCTGG + Intronic
962911965 3:139860649-139860671 ATAAGATCAAGGAGGCAGTGTGG - Intergenic
964466883 3:157003465-157003487 GTAAAATCAAGGTGTCAGCAGGG + Intronic
964542065 3:157790394-157790416 ATTAAGTCTAGGTGACATTCTGG + Intergenic
964750536 3:160050127-160050149 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
964908213 3:161744422-161744444 ATCCAATCAAGTTGACACTCTGG - Intergenic
965017995 3:163185409-163185431 ATAAAATCTTGATGATAGTCAGG - Intergenic
965191284 3:165532240-165532262 ATCTAAGCAAGTTGACAGTCAGG + Intergenic
965312009 3:167140057-167140079 CTAAAATCAAGTTGTCAGTAGGG - Intergenic
965410207 3:168320666-168320688 CTAAAATCAAGGTGTCAGCATGG - Intergenic
965537933 3:169843405-169843427 CTAAAATCAAGGTGTCAGCCTGG - Intronic
965555921 3:170018360-170018382 CTAAAATCAAGGTGTCAGCCAGG + Intergenic
965726957 3:171728012-171728034 AAAAAGTCAAGGTCTCAGTCAGG + Intronic
966049814 3:175601786-175601808 AAAACATAAAGTTGACAGTCTGG - Intronic
966600881 3:181773941-181773963 ATAAAATAAATGTGACTGTGGGG + Intergenic
967409228 3:189150717-189150739 AGAAAATCAATGTGACCATCTGG - Intronic
968390326 4:187527-187549 AAAAAACCAAGGTGACTGCCAGG - Intergenic
969085541 4:4653383-4653405 ATAAAATCAAAGTGATGGGCAGG - Intergenic
969085585 4:4653716-4653738 TTAAAATCAAGGTGATTGGCTGG - Intergenic
969224265 4:5784459-5784481 TTAAAATCAAGGTGTCAGCAGGG - Intronic
969695491 4:8731896-8731918 ATAATGTCAAGGTGTCAGTGAGG - Intergenic
970262747 4:14245625-14245647 ATGAAATCAAGGTGTCTGTCAGG - Intergenic
970410091 4:15797638-15797660 CTAAAATCAAGGTGTCAGAAGGG + Intronic
970648197 4:18147345-18147367 CTGAAATCAAGGTGACAGAAAGG + Intergenic
970921173 4:21396862-21396884 CTAAAATCAAGGTGTCAGCAAGG - Intronic
971285195 4:25282208-25282230 CTGAAATCAAGGTGCCAGTAGGG + Intergenic
971778204 4:30995660-30995682 CTAGAATCAAGGTGTCAGTAAGG + Intronic
972031441 4:34464355-34464377 TTGAAATCAAGGTGACAGATGGG + Intergenic
973599726 4:52529949-52529971 CTAAAATCAAGGTGTCAGTGGGG - Intergenic
974232843 4:59138850-59138872 ATAAAATCTAGCTGACATTTGGG + Intergenic
974378853 4:61111709-61111731 CGAAAATCAAGGTGGCAGCCAGG - Intergenic
974384754 4:61189977-61189999 TCAAAATCAAGGTGACAGCAGGG - Intergenic
974455243 4:62122341-62122363 TTAAAGTCAAGGTGTCAGTAGGG + Intergenic
974471165 4:62319665-62319687 CTACAATCAAGGTGTCAGTAGGG - Intergenic
975412799 4:74074406-74074428 CTAAAATCGAGGTGTCAGTAGGG - Intergenic
975571053 4:75818208-75818230 CTACAATCAAGGTGTCAGCCAGG - Intergenic
975709943 4:77151032-77151054 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
976048204 4:80978184-80978206 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
976266196 4:83187302-83187324 ATAAAAACAAGATGACAGCTGGG + Intergenic
976515801 4:85965030-85965052 AAAAGATCAATGTGACAGTTTGG + Intronic
976584230 4:86777218-86777240 GTAAAATCAAGGTGTCAGCAGGG + Intronic
976624435 4:87164850-87164872 ATAAAAACAAGGTCAGAGGCCGG + Intronic
976784042 4:88797559-88797581 ATAAAAACTACGTGACAGGCTGG - Intronic
976891197 4:90049850-90049872 TTAAAATCAAGGTGTCAGCAAGG + Intergenic
977787227 4:101050750-101050772 AAAAAATAAATGTGCCAGTCAGG + Intronic
978020299 4:103801413-103801435 CTCAAATCAAGGTGTCAGTAGGG + Intergenic
978280388 4:107005005-107005027 CTAAAATCAAGGTGTCAGTAGGG - Intronic
978428010 4:108602517-108602539 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
979398443 4:120218239-120218261 ATAAATTCAAGGTGAGATTTGGG + Intergenic
979817344 4:125126092-125126114 CTAAAATCTAGGTGGCATTCTGG - Intergenic
980408571 4:132384728-132384750 CTGAAATCAAGGTGTCAGTGGGG - Intergenic
980719995 4:136683079-136683101 TCAAAATCAAGGTGTCAGTCAGG + Intergenic
981786098 4:148481306-148481328 AAGAAATCAAGGTGGAAGTCAGG - Intergenic
981988941 4:150892531-150892553 CTAAGATCAAGATGCCAGTCGGG - Intronic
982417266 4:155150349-155150371 ATGCAACCAAGGTGTCAGTCAGG + Intergenic
982972324 4:162004886-162004908 ACAAAATCATGGGGACAGTTGGG - Intronic
983035359 4:162858345-162858367 CTAAAATCAAGGTGGCAGCAGGG + Intergenic
983090612 4:163497502-163497524 ATAAAATTAAGGTGTTTGTCAGG + Intronic
983771948 4:171561693-171561715 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
984078374 4:175212681-175212703 ATGAAATCAAGGTGTCAGCAGGG - Intergenic
984402331 4:179282316-179282338 CTAAAATCAAGGTGTCAACCGGG - Intergenic
984418871 4:179494502-179494524 ATAAAATCAAGGAGTTGGTCAGG + Intergenic
985293281 4:188407713-188407735 ATAGAATGAAGGTGACAGCAGGG - Intergenic
986119900 5:4824943-4824965 CTAAAATTAAGGTGTCAGTGCGG - Intergenic
986414475 5:7514879-7514901 TTAAAATCAAGGTGTCAGCAGGG - Intronic
986790477 5:11154739-11154761 CTAAAATCAAGGTGCCAGCAGGG + Intronic
986855669 5:11865952-11865974 CTAAAATCAAGGTGTCACTAGGG - Intronic
987451070 5:18084670-18084692 ATAAAATCAGGTAGACACTCTGG + Intergenic
988003125 5:25375064-25375086 CTAAAATCAAGGTGTCAGTAGGG - Intergenic
988151140 5:27382511-27382533 AGAAAATGGAGGTGACAGGCAGG + Intergenic
988385433 5:30558484-30558506 ATAAAATCAAGATAACACACTGG - Intergenic
988393387 5:30664939-30664961 CCAAAATCAAGGTGTCAGCCGGG - Intergenic
988475495 5:31581301-31581323 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
989752970 5:44918294-44918316 ATAAAATCAAGGTGTCTGCAGGG + Intergenic
989765401 5:45076694-45076716 ATATAATCAAGTTGCCACTCAGG + Intergenic
991259833 5:64655000-64655022 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
992646553 5:78816903-78816925 CTGAATTCAAGGTGTCAGTCAGG - Intronic
992717413 5:79524882-79524904 AAAAAATCAAAGTGAGAGCCGGG + Intergenic
993299355 5:86188242-86188264 ATAAAATCAGGGAGAGAGACTGG + Intergenic
993318409 5:86440791-86440813 CTAAAATCAAGGTATCAGCCAGG + Intergenic
993553361 5:89303791-89303813 AAATATTCAAGGTGAAAGTCTGG - Intergenic
994797565 5:104324004-104324026 TTAAAATCAAGGTGTCAGTAGGG + Intergenic
994881316 5:105500707-105500729 CCAAAATCAAGGTGTCAGGCAGG + Intergenic
995154736 5:108897225-108897247 ATAAAATCAAGGTGACAGTCTGG - Intronic
996026098 5:118647580-118647602 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
996368570 5:122728587-122728609 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
996560225 5:124820522-124820544 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
996562022 5:124841283-124841305 TTAAAATCAAACTGAAAGTCTGG + Intergenic
996816907 5:127584177-127584199 CTAAAATTAAGGTGTCAGTTGGG - Intergenic
996846454 5:127904250-127904272 CTAAAATCAAGGTTACAGTAAGG - Intergenic
997039174 5:130231892-130231914 ACAAAATCAAGTTGTCAGTGGGG + Intergenic
997617875 5:135264778-135264800 ATTAAATAAATGTCACAGTCTGG - Intronic
998221526 5:140285841-140285863 ATAAAACCAAGGGGGCAGCCAGG + Intronic
999580184 5:153029984-153030006 CTAAAATCAAGGTGATTGGCAGG + Intergenic
999638686 5:153649190-153649212 CTAAAATCAAGGTGTCAGCAGGG - Intronic
999897449 5:156050691-156050713 CTAAAATCAAGGTGTCAGCAGGG + Intronic
999937886 5:156507409-156507431 CTAAAATCAAGGTGTCAGAAGGG - Intronic
1000021975 5:157326072-157326094 ATAGAAACAAGTTCACAGTCAGG - Intronic
1000241299 5:159410954-159410976 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1000263938 5:159616852-159616874 CTTTAATCAAGGTGTCAGTCCGG + Intergenic
1000364865 5:160481328-160481350 ATAAAAACAAGGTGATAGGCTGG - Intergenic
1000971634 5:167721437-167721459 CTAAAATCAAGGTGTTAGTTGGG + Intronic
1001370336 5:171193598-171193620 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1002208451 5:177580596-177580618 CCAAAATCAAGGTGACAGCAGGG - Intergenic
1002652790 5:180714418-180714440 TTAAAATCAAGGTGTGAGTAGGG + Intergenic
1003061094 6:2863347-2863369 CTAAGATCAAGGTGTCAGTAAGG + Intergenic
1003315829 6:5011138-5011160 AAAAAAACAAGGTCACATTCTGG - Intergenic
1003429332 6:6024658-6024680 CTAAGATCAAGGTGTCAGTAGGG + Intergenic
1003825943 6:9952110-9952132 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1003840750 6:10116891-10116913 CTATAATCAAGGTGTCAGCCAGG + Intronic
1004371976 6:15060559-15060581 CCAAAATCAAGGTGACAGGAAGG + Intergenic
1004475278 6:15965924-15965946 CCAAAATCAAGGTGACAGGAGGG - Intergenic
1004740929 6:18460146-18460168 TTAAAATCAAGGTGTCAGCCGGG + Intronic
1005173189 6:23012024-23012046 ATCCAATCAAGTTGACACTCAGG - Intergenic
1005175691 6:23041977-23041999 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1005336744 6:24804192-24804214 ATAAAATAAAGGTGAAAATGAGG + Intronic
1005375550 6:25178904-25178926 ATGAAATCAAGGTGGCAGTAGGG + Intergenic
1005902429 6:30228521-30228543 CTAAAATCAAGTTGTCAGTGTGG + Intergenic
1007827399 6:44611005-44611027 CTAAAATCAAAGTGACAGCAGGG + Intergenic
1008050622 6:46897180-46897202 ATAAATTCAAGGGGCCAGTTAGG + Intronic
1008674367 6:53803812-53803834 ACACAATCAAGGAGTCAGTCTGG - Intronic
1008703641 6:54131238-54131260 TTGAAATCAAGGTGTCAGTCAGG + Intronic
1008890969 6:56489812-56489834 ATTAAAACAAAGTGACAGTGGGG - Intronic
1008935349 6:56986275-56986297 ATAAAATAAAGGTGAGGGCCAGG + Intronic
1008936220 6:56995526-56995548 ACAAAATCAAGGTGTCAGCAGGG + Intronic
1008983618 6:57515854-57515876 CTAAAATCAAGGTGTCAGCAAGG + Intronic
1009171674 6:60408759-60408781 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1009284708 6:61802202-61802224 CTAAAATCAAAGTGTTAGTCAGG - Intronic
1009663103 6:66640003-66640025 ATATAATTAAGGTGACACTGGGG + Intergenic
1010117135 6:72327066-72327088 CTAAAATCAAGGTGTCAGCTGGG - Intronic
1010321751 6:74518338-74518360 CTAAAATCAAGGTGCCAGTAGGG - Intergenic
1011019574 6:82797215-82797237 CTAAAATCAATGTGTCAGCCAGG + Intergenic
1011759767 6:90549637-90549659 AAAAATTCAAGGTCACAGTAAGG + Intronic
1012254070 6:97012475-97012497 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1012334080 6:98031611-98031633 ACAAAGTTAAGGGGACAGTCTGG + Intergenic
1012466310 6:99520443-99520465 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1012553973 6:100490086-100490108 CTAAAATCAAGTTGTCAGTAGGG + Intergenic
1012558623 6:100549439-100549461 AGAAAACCAAGGTGACACACAGG - Intronic
1012569271 6:100701738-100701760 ATAATAAGAAGGTGACAGTCAGG + Intronic
1013312193 6:108906119-108906141 TTAAAATTAAGATGACTGTCTGG - Intronic
1013722542 6:113048343-113048365 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1013861447 6:114640547-114640569 TAAAAATCAAGGTGTCAGTAGGG - Intergenic
1014252086 6:119126049-119126071 ATAAAATTAAGGTGTCAGCGAGG + Intronic
1014394638 6:120910824-120910846 AGAAGATCAAGGTGAGAGACTGG - Intergenic
1014987170 6:128025655-128025677 CCAAAATCAAGGTGTCAGTAGGG + Intronic
1015737798 6:136419652-136419674 TCAAAATCAAGATGACATTCAGG + Intronic
1015951720 6:138559745-138559767 ATAAAATCAAGTAGTAAGTCAGG + Intronic
1016145643 6:140669364-140669386 TTAAAATCAAGGTCTCAGTAAGG + Intergenic
1016697795 6:147018003-147018025 TCAAAATCAAGGTGGCAGTAGGG + Intergenic
1017741400 6:157409794-157409816 ATAAAATAAAGCTGCCAGTGAGG - Intronic
1018392098 6:163348445-163348467 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1018415450 6:163598449-163598471 ACAAAAGCACAGTGACAGTCTGG + Intergenic
1018711368 6:166500173-166500195 ATGAAATCAAGGTGTCAGCAGGG - Intronic
1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG + Intronic
1021483274 7:21141855-21141877 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1021512399 7:21448465-21448487 TTAAAATGAAGGTGACATTGTGG + Intronic
1021777637 7:24068989-24069011 ATAGAATCATGGAGAAAGTCTGG + Intergenic
1022477542 7:30721567-30721589 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1023019878 7:36001744-36001766 CTAAAAGCAAGGTGTCAGCCAGG - Intergenic
1023031032 7:36090542-36090564 TTAAAATCAAGGTGTCAGTCAGG - Intergenic
1023754195 7:43400826-43400848 CTAAAATCAAGCTGTCAGCCAGG + Intronic
1023823539 7:43993541-43993563 AAAAAAAAAAGGTGACAGGCTGG - Intergenic
1023892159 7:44400641-44400663 CTGAAATCAAGGTGTCAGTAGGG + Intronic
1024193106 7:47032641-47032663 ATAAAATCTAGGACACAGTTTGG + Intergenic
1024509702 7:50194036-50194058 ATAAAATCAGGTTGAAAGTTGGG + Intergenic
1025697686 7:63788159-63788181 ATACAATCAGGGTGTCAGCCAGG - Intergenic
1025829409 7:65036842-65036864 ATACAATCAAGCTGTCAGCCAGG - Intergenic
1025916627 7:65871782-65871804 ATACAATCAAGCTGTCAGCCAGG - Intergenic
1027596576 7:80181729-80181751 TCAAAATCAAAGTGACAGTGGGG + Intronic
1027724067 7:81780981-81781003 ATAAAATCAAGGTGACAGCAGGG - Intergenic
1028043397 7:86087752-86087774 ATCCAATCAAGCTGACACTCAGG - Intergenic
1028404157 7:90458069-90458091 AGAAAATCAAGGATTCAGTCGGG + Intronic
1029751804 7:102546994-102547016 AAAAAAAAAAGGTGACAGGCTGG - Intronic
1029769756 7:102646085-102646107 AAAAAAAAAAGGTGACAGGCTGG - Intronic
1030313702 7:108092915-108092937 ATAAAATGAAGGGGACAGGAAGG + Intronic
1030629120 7:111875764-111875786 CTAAAATCAAGGTGCCAGCAGGG - Intronic
1031069845 7:117150060-117150082 GAATAATTAAGGTGACAGTCTGG - Intronic
1031622941 7:123957670-123957692 ATAAAATCAAAGTGACAGCAGGG + Intronic
1032529227 7:132606260-132606282 CTAAAATCAAGGTGACTGCAGGG - Intronic
1033289690 7:140072779-140072801 CCAAAATCAAGGTGTCAGTAGGG - Intergenic
1033889127 7:145986607-145986629 CTAAAATCAAGATGGCAGTTGGG - Intergenic
1034199179 7:149271232-149271254 ATAAAATCAAAGAGCCAGGCTGG - Intronic
1035795332 8:2351328-2351350 GTAAATTCAAGGTGGAAGTCAGG + Intergenic
1035993868 8:4523621-4523643 AGAAAACCAAGGTTCCAGTCCGG + Intronic
1036515685 8:9441289-9441311 ATAAAAATAAGGTGTCAGTCAGG - Intergenic
1037615038 8:20511304-20511326 CTGAAATCAAGGTGTCAGTTAGG - Intergenic
1037932836 8:22892905-22892927 CTCAACTCAAGGTGACTGTCAGG - Intronic
1038849819 8:31264887-31264909 CTGAAATCAAGGTGTCAGCCTGG - Intergenic
1038888158 8:31688904-31688926 CTAAAATCAAGGTGTCAGGAGGG + Intronic
1039134558 8:34306182-34306204 ATAAAATTAAGGTGTCAGTAGGG + Intergenic
1039369750 8:36972728-36972750 ACAAAAGGAAGGTGACATTCAGG + Intergenic
1039534340 8:38294618-38294640 ATAAAATCAAGTTTATATTCTGG - Intronic
1040977125 8:53205853-53205875 CTGAAATCAAGGTGTCAGTGGGG - Intergenic
1041056055 8:53987480-53987502 AAAAAATAAAAGAGACAGTCAGG + Intronic
1041242801 8:55862610-55862632 AGAAAATAAAGGTGACAGGTGGG - Intergenic
1041659626 8:60388726-60388748 ATAAATTCAAGGAGAAAGTAAGG + Intergenic
1041895119 8:62915485-62915507 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1041957371 8:63570862-63570884 ATGAAATCAAGGTGTCAGAAGGG - Intergenic
1042127672 8:65555082-65555104 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1042236841 8:66621705-66621727 CTAAAATCAAGGTGTCAGGAGGG + Intergenic
1042521872 8:69721424-69721446 ATAAAATAAAAGTGAGACTCTGG + Intronic
1043210958 8:77516964-77516986 ATTAACTAAGGGTGACAGTCAGG - Intergenic
1043646538 8:82527562-82527584 CTGAAATCCAGGTGACAGCCCGG - Intergenic
1044017375 8:87060170-87060192 CTAACATCAAGGTGTCAGTTGGG - Intronic
1044066976 8:87710393-87710415 ATAAAATCGATGTAGCAGTCAGG - Intergenic
1044210936 8:89550691-89550713 AAGAAATCAAGGGGACAGGCTGG + Intergenic
1044226457 8:89724561-89724583 CTAAAATCATGGTGTCAGTAGGG + Intergenic
1044543318 8:93431700-93431722 CCAAAATCAAGGTAACAGCCAGG + Intergenic
1044598073 8:93977737-93977759 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1044963234 8:97551689-97551711 ATGAAATCAAGGTGTCAGCAAGG + Intergenic
1045000310 8:97872537-97872559 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1045117978 8:99004471-99004493 AGAAAATCAAGGTGTCAGCAGGG + Intergenic
1045139386 8:99263471-99263493 CTAAAATCAAGGTGTCAGTTGGG + Intronic
1046378235 8:113416196-113416218 ATTAAAGCAAAGTGACAATCTGG + Intronic
1046565324 8:115892187-115892209 AAAAAATGAAGTTGACAGTTTGG + Intergenic
1046839195 8:118838718-118838740 CCAAAATCAAGGTGTCAGTAGGG + Intergenic
1047295879 8:123570176-123570198 CTAAAATCAAGGTGTCAATAGGG - Intergenic
1047324725 8:123825289-123825311 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1048395728 8:134012121-134012143 GTAAAATCAGGGTGTCAGTAAGG - Intergenic
1048455609 8:134575499-134575521 CTAAAATCAAGGTGTCAGCCTGG - Intronic
1049073441 8:140374767-140374789 CTAAAATAAAGGTGACAGCCGGG + Intronic
1050619805 9:7440713-7440735 ATCAATTCAAGTTGATAGTCAGG - Intergenic
1051349087 9:16182196-16182218 AAAAAATCAAGGGGATAGTGAGG + Intergenic
1051640364 9:19219401-19219423 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1051728834 9:20117034-20117056 ATGAAATGAAGGTGAGAGACTGG - Intergenic
1052027076 9:23585461-23585483 CTAAAACCAAGGTGCCAGACAGG + Intergenic
1052377038 9:27729329-27729351 ATCAATTCCAGGTGACTGTCAGG + Intergenic
1053214729 9:36260961-36260983 CCAAAATCAAGGTGTCAGTTGGG + Intronic
1053731355 9:41060109-41060131 TCAAAATCAAGGTGTCAGTGGGG + Intergenic
1054697153 9:68371981-68372003 TCAAAATCAAGGTGTCAGTGAGG - Intronic
1054744459 9:68840526-68840548 CTAAAATCAAGGTGTCAGTGTGG + Intronic
1054990203 9:71316702-71316724 CTAATATCAAGGTGTCAGTTGGG - Intronic
1055095850 9:72413325-72413347 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
1056164388 9:83927283-83927305 TTGCAATCAAGGTGTCAGTCAGG + Intergenic
1056223015 9:84468407-84468429 CTGAAATCAAGGTGTCAGTAGGG - Intergenic
1057415451 9:94858451-94858473 CTAAAATCAAGGTGGCAGCAGGG + Intronic
1057434783 9:95029797-95029819 ATGAAATCCAGGTGATAGTCTGG + Intronic
1057954338 9:99395858-99395880 TTAAAATCAAGCTGCCAGTGGGG - Intergenic
1058132525 9:101268939-101268961 ATGAAATAAAGGTGTCAGACAGG + Intronic
1058513343 9:105743207-105743229 TTAAAATCAAAGTGTCAGTAGGG - Intronic
1058671039 9:107360519-107360541 CTAAAATCAAGGTGCCAGCAGGG + Intergenic
1060203317 9:121666051-121666073 CTAAAATCAAGGTGTCAGCAGGG + Intronic
1185843230 X:3412950-3412972 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1186148965 X:6654115-6654137 CTGAAATCAAGGTGTCTGTCAGG - Intergenic
1186174725 X:6913936-6913958 ATAAAATCACAGTTACGGTCAGG + Intergenic
1186219832 X:7338221-7338243 ATAAAATCAAGTTGTCATTGTGG - Intronic
1186422023 X:9433892-9433914 ATGAAATCAAGGTGTCAGTTGGG - Intergenic
1186590338 X:10924149-10924171 AAATTATCTAGGTGACAGTCTGG - Intergenic
1186633459 X:11376537-11376559 CTAAAATCAAGGTGTCAGCAGGG - Intronic
1186676060 X:11818593-11818615 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1186755756 X:12669828-12669850 CTAAAATCAAGGTGTCAGCTGGG - Intronic
1186765249 X:12763946-12763968 ATAAAATCAAGATGTCGGCCAGG + Intergenic
1186790844 X:12997019-12997041 CTGAAATCAAGGTGTCAGCCTGG + Intergenic
1186865639 X:13718086-13718108 CTGAAATCAAGGTGTCAGTGGGG - Intronic
1186961706 X:14743729-14743751 ATGAAATCAAGGTGTCAGCAGGG + Intergenic
1187536829 X:20148603-20148625 CTAAAATCAAGGTGTCAGCAAGG - Intergenic
1187783121 X:22851879-22851901 CTAAAATCACCTTGACAGTCTGG - Intergenic
1187853073 X:23610127-23610149 TTAAAATCAAAGTGACAGGATGG - Intergenic
1188206380 X:27364129-27364151 CTGAAATCAAGGTGTCAGTGGGG + Intergenic
1188283320 X:28297621-28297643 ATAAAATCAAGGTGTTGGTAGGG - Intergenic
1188380998 X:29492415-29492437 CTAAAATCAAGGTATCAGTAGGG + Intronic
1188798212 X:34492978-34493000 ATAAAATCAGGGTATCAGCCAGG + Intergenic
1188847843 X:35095924-35095946 CTAAAATCCAGGTGTCAGTCAGG + Intergenic
1188905435 X:35785763-35785785 CCAAAATCAAGGTGCCAGCCAGG + Intergenic
1189158370 X:38783591-38783613 ATGAAATCAAGGTGTCAGTAAGG - Intergenic
1189203403 X:39217135-39217157 TTAGAATCAAGGTGACAGCAGGG - Intergenic
1189729611 X:44005260-44005282 CTAAAATCAAGGTGTCAGCAAGG + Intergenic
1189755290 X:44265244-44265266 ATAAAATAGAGGTGAGAGTTTGG - Intronic
1191025953 X:55913618-55913640 ATGAAATCAAGGTGTCAGCAGGG - Intergenic
1191667795 X:63721200-63721222 ATAAAAGCCAGGTCACACTCTGG + Intronic
1192039450 X:67602739-67602761 CCAAAATCAAGGTGTCAATCAGG - Intronic
1192093698 X:68187527-68187549 CTAAAATCAAGGTGTCAGCAAGG - Intronic
1192467087 X:71365114-71365136 AAAAAAGCAAGGTGAAAGCCGGG + Intergenic
1193079978 X:77397274-77397296 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1193489555 X:82132782-82132804 AAAAAATCAAGATGATATTCTGG + Intergenic
1193667632 X:84341888-84341910 CTAAAATCAAGGAAAGAGTCGGG - Intronic
1193965161 X:87975972-87975994 AGAAAATCTAGGTGAAAGCCTGG + Intergenic
1194753342 X:97708204-97708226 ATACAATCAAAGCAACAGTCTGG - Intergenic
1194834236 X:98661157-98661179 ATTCAATCAAGTTGACACTCAGG - Intergenic
1195033975 X:100954121-100954143 CTAAAATCAAAATGACAGCCGGG + Intergenic
1195288154 X:103405339-103405361 CTAAAATCAAGGTGTCAGCAGGG + Intergenic
1195588724 X:106599281-106599303 AGAAAATCAAGGTGCCAGTATGG + Intergenic
1195832880 X:109078823-109078845 ATAAAATCAAGGTGTCAGTTGGG - Intergenic
1195900484 X:109792441-109792463 CCAAAATCAAGGTGCCAGCCGGG + Intergenic
1196228611 X:113194812-113194834 CTAAAATCAAGGTGTCAGTAAGG - Intergenic
1196502936 X:116406780-116406802 CTAAAATCAAGGTGTCAGGAGGG + Intergenic
1196557465 X:117106071-117106093 TTAAAATGAAGGTGACAATCTGG + Intergenic
1196940899 X:120774835-120774857 GTAAAATCAAGGTTTCAGCCAGG + Intergenic
1197029119 X:121792320-121792342 CCAAAATCAAGGTGTCAGTGGGG + Intergenic
1197505072 X:127291631-127291653 ACAAAATCAAGGTGTCAGTGAGG - Intergenic
1197781711 X:130166336-130166358 AATAAATAAAGGTGACAGGCGGG - Intergenic
1198279967 X:135132197-135132219 CTAAAATCAAGGTGCCAGCTGGG + Intergenic
1198290990 X:135240317-135240339 CTAAAATCAAGGTGCCAGCTGGG - Intergenic
1198377352 X:136052976-136052998 CTAAAATCAAGGGGACGGTGGGG - Intergenic
1199161443 X:144616922-144616944 CTGAAATCAAGGTGTCAGTGGGG - Intergenic
1199539824 X:148946549-148946571 TTAAAATCAAGGTGGCAGCATGG + Intronic
1199750259 X:150809146-150809168 CTAAAATCAAGGTGCTAGCCAGG - Intronic
1200013176 X:153136074-153136096 AAGAAATCAAGGTGAGAGTCTGG - Intergenic
1200026424 X:153263849-153263871 AAGAAATCAAGGTGAGAGTCTGG + Intergenic
1200277061 X:154743917-154743939 ATTAAAACAAGGTGAGAGGCTGG + Intronic
1201231965 Y:11873629-11873651 CTAAAATCAAGGTGTCAGCAGGG - Intergenic
1201239458 Y:11944690-11944712 CTAAAATCAAAGTGTCAGCCAGG + Intergenic
1201598133 Y:15695024-15695046 GTAAAATCAAGGTGTCAGCTGGG - Intergenic