ID: 995159116

View in Genome Browser
Species Human (GRCh38)
Location 5:108954878-108954900
Sequence GTCCATCAGAATATACAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995159116 Original CRISPR GTCCATCAGAATATACAGAA AGG (reversed) Exonic
903762266 1:25706991-25707013 GTCCAGCAGAAGAGACAGAATGG + Intronic
904977585 1:34469937-34469959 GAACATCAGCATATAGAGAATGG - Intergenic
905827305 1:41035543-41035565 GTCCATCAGTGAATAGAGAAAGG - Intronic
907699895 1:56775766-56775788 GGTCATCAGAGTATACAGCAAGG + Intronic
907857127 1:58314356-58314378 GGCCAACTGAATAAACAGAAAGG - Intronic
909261942 1:73501250-73501272 GAACGTCAGAAAATACAGAAAGG + Intergenic
909501408 1:76339031-76339053 GTTCATCAGAATGTAGGGAAAGG - Intronic
911026430 1:93440343-93440365 GGCCACCAGATTACACAGAAGGG - Intergenic
911734805 1:101325098-101325120 GTCAATCAGAAAAGAAAGAAAGG - Intergenic
915794333 1:158711657-158711679 ATACATAAAAATATACAGAATGG - Intergenic
916163945 1:161947701-161947723 GTATATCAGAATTCACAGAAAGG + Intronic
918524065 1:185446034-185446056 GTCCAACAGGATATCCAGAAGGG + Intergenic
920601360 1:207328181-207328203 GAACATCAGAATATTCAGCATGG - Intronic
921464363 1:215468721-215468743 GTAATTCAGAATATACAGACTGG + Intergenic
921745116 1:218731690-218731712 GGCCATAAGAATAAAGAGAAAGG - Intergenic
1064118688 10:12600815-12600837 GTACATGTGAACATACAGAATGG - Intronic
1065357577 10:24857371-24857393 GTACATCTGAATACACTGAATGG + Intronic
1065648423 10:27861672-27861694 CTGCATCAAAAAATACAGAAAGG - Intronic
1067688934 10:48488625-48488647 GTAGGACAGAATATACAGAAGGG - Intronic
1067857839 10:49811967-49811989 GTTCTCCAAAATATACAGAAAGG - Intergenic
1068695920 10:59968128-59968150 CTCCATCATAAAAGACAGAAAGG - Intergenic
1070796896 10:79222110-79222132 GTCAATCAGAAAACACAGACTGG + Intronic
1073813276 10:107175290-107175312 CTCCCCCAGAATATAGAGAAAGG - Intergenic
1074233100 10:111557258-111557280 GTCCATCTGAATAAACATGAAGG - Intergenic
1074951725 10:118343270-118343292 TTTCATCAGGATATCCAGAATGG - Intergenic
1074974269 10:118567601-118567623 GTCCGTCGGAAGAAACAGAATGG + Intergenic
1076941573 10:133613581-133613603 GTGGATCAGAATATAGATAAGGG + Intergenic
1080322441 11:31028024-31028046 GTGCTTTAGATTATACAGAAGGG - Intronic
1080356447 11:31452565-31452587 TTCCTGTAGAATATACAGAAAGG + Intronic
1081224576 11:40504366-40504388 GTCCATCAGAATATCCTCCATGG - Intronic
1086965248 11:93020588-93020610 GTCCATAAGGAAATGCAGAAGGG + Intergenic
1087247507 11:95856272-95856294 GTCCAGCAGGGTATACTGAAAGG - Intronic
1091179252 11:133588750-133588772 GTCCTTCAGACTAAACTGAAGGG + Intergenic
1092965200 12:13634661-13634683 GTCCATCTGTATACCCAGAAAGG + Intronic
1097548665 12:61037991-61038013 GTGCATCAGAGTGTTCAGAAAGG + Intergenic
1097806271 12:63968233-63968255 GTACATCAGAAGTTACAAAATGG + Intronic
1103199468 12:119075075-119075097 ATCCATCAGACCTTACAGAAGGG - Intronic
1104008997 12:124915493-124915515 GGCCCTCAGAATGTACAGGAAGG - Intronic
1107367021 13:39691635-39691657 GTCTATCAGTATATAAGGAAGGG - Intronic
1107798427 13:44079510-44079532 GTTCATCAGGATAAGCAGAATGG + Intergenic
1108280530 13:48856822-48856844 GTCCTTAAAAATATACAAAAGGG + Intergenic
1108755136 13:53491487-53491509 ATCCTTCAGAATAGACAGATGGG - Intergenic
1109099835 13:58168232-58168254 GTCAATCAGAATACAATGAAAGG + Intergenic
1109985322 13:69975214-69975236 TTCCATCAGAAACTAAAGAAAGG - Intronic
1110813756 13:79839437-79839459 GACTATCAGAATATCCACAATGG - Intergenic
1111607291 13:90556904-90556926 GTCAATCTATATATACAGAAAGG - Intergenic
1112789770 13:102990105-102990127 ATCCATCAGCATATACTGATAGG + Intergenic
1115791475 14:36883532-36883554 TTCCATCAGAAGAGACAGACAGG - Intronic
1119586664 14:75842271-75842293 GTCCAGAGGAATAGACAGAAAGG - Intronic
1123892199 15:24793071-24793093 GTGCATCAGAATTTGCATAATGG - Intergenic
1125063598 15:35455401-35455423 ATCCAGCAGTATATACAGCATGG + Intronic
1129248522 15:74294994-74295016 GCTCATCAGAATATACAGAGAGG + Intronic
1130217936 15:81989832-81989854 GTCCATCAGAATTATCTGAAAGG + Intergenic
1130981236 15:88813040-88813062 GTCCATCAGCATATTAAGAAGGG - Intronic
1133196887 16:4177367-4177389 GTCTATCAGAACAAACATAAAGG + Intergenic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1137409972 16:48220139-48220161 GGTGCTCAGAATATACAGAAAGG + Intronic
1139163943 16:64543861-64543883 GTCCATCAGAATCCCTAGAAGGG - Intergenic
1141271483 16:82544937-82544959 GTCCGTCAGCATATACATACAGG - Intergenic
1145067202 17:19769813-19769835 GTCCATCAGACACTACAGATAGG + Intergenic
1147773564 17:42884552-42884574 GTCCATCAGAAGGTGCAGAAAGG + Intergenic
1151521931 17:74636433-74636455 GACCATGGGAATATACAGAAGGG - Intergenic
1152397101 17:80040158-80040180 GTCCACCAGAATCCAGAGAAAGG + Exonic
1155566950 18:27145924-27145946 GTACATAAGAAGATTCAGAAAGG + Intronic
1156701892 18:39835722-39835744 GTCCTTAAGAAATTACAGAAGGG - Intergenic
1158732560 18:60040591-60040613 TTCAATCAGTATATACTGAATGG - Intergenic
1162417804 19:10548646-10548668 GACCAAAAGTATATACAGAAGGG - Intronic
1165565222 19:36720372-36720394 GTACATCAGAAAATACATACCGG + Exonic
1166265979 19:41684670-41684692 GTCCAGAAGAAGATAGAGAAAGG + Intronic
1166615016 19:44235955-44235977 GTCCATCAGAATGTCCACACTGG + Exonic
925700719 2:6634720-6634742 GTCTTTCAGAATATACAGGGAGG - Intergenic
927036534 2:19183412-19183434 TTCCATTAAAAGATACAGAATGG - Intergenic
928260239 2:29760251-29760273 GTCCAACAGACTCTACAGATAGG - Intronic
928281941 2:29954539-29954561 GTCCATAAGAAAACACAAAATGG + Intergenic
928682291 2:33714865-33714887 TTCCAGCAGAATATAGAGAATGG - Intergenic
933234014 2:79844332-79844354 GTACATCAAAATATAAAGCAGGG - Intronic
934571732 2:95376893-95376915 GTCTCTAAGAATATACAGAAAGG - Intronic
935883519 2:107591108-107591130 GTCCATAAGCAGATACTGAAAGG - Intergenic
937451816 2:122008514-122008536 CCCCATCAGAAGTTACAGAAAGG - Intergenic
939617212 2:144375134-144375156 GTCCATCAGAACATACCTCAAGG - Intergenic
940716656 2:157233490-157233512 GAAGATTAGAATATACAGAAGGG - Intergenic
942102486 2:172598971-172598993 CTCCATTAGAATATACACATTGG - Intronic
944138849 2:196433044-196433066 TTCCAGAAGAAAATACAGAATGG + Intronic
945323261 2:208451926-208451948 GTCTGTCAAAATATAAAGAAAGG - Intronic
946288788 2:218727252-218727274 GTCTATCTGAAAATACACAAAGG - Exonic
1169705298 20:8496570-8496592 GTCCATCAGCATTTACTAAAGGG - Intronic
1170869980 20:20196550-20196572 GTCCTACAGAAGAGACAGAAGGG - Exonic
1182777886 22:32844256-32844278 GTTCATCAGCATAAACAGAGTGG - Intronic
1183175308 22:36219872-36219894 CCCCATCAAAATATATAGAAGGG + Intergenic
951053160 3:18117790-18117812 GTCCATAAAAATATAAAGACAGG - Intronic
951547343 3:23840561-23840583 ATCCAGCAGAATACTCAGAATGG - Intronic
953463006 3:43096505-43096527 GTCCCTCAGCATGTACAGAATGG + Intronic
957194760 3:77053369-77053391 GAGCATGAGTATATACAGAAGGG - Intronic
957897093 3:86436643-86436665 GTCCATCAAAATAGAAAGAATGG - Intergenic
957907407 3:86575870-86575892 TTCCATCAAAAGATATAGAATGG - Intergenic
958150964 3:89694507-89694529 GTCCATGAGACTATACAGTGTGG + Intergenic
962058741 3:131902847-131902869 GTCAATGAGAATATTTAGAAGGG + Intronic
966666121 3:182472847-182472869 GTCCCCCAGAGTCTACAGAAGGG - Intergenic
967489252 3:190070351-190070373 GTACATAGGAAGATACAGAAGGG + Intronic
967516579 3:190376506-190376528 TTCCATAGGAATATACAGCAAGG + Intronic
968499126 4:937810-937832 ATCCAACACTATATACAGAAAGG + Intronic
969965045 4:10985354-10985376 GTTCTGGAGAATATACAGAATGG - Intergenic
971072669 4:23112411-23112433 ATCCCCCAGAATGTACAGAAGGG - Intergenic
971604671 4:28642062-28642084 GTGCATAAGAGTATAAAGAAAGG + Intergenic
974220275 4:58960408-58960430 TTTCATAAGAATATACAGAATGG + Intergenic
975861470 4:78681750-78681772 GTCTAAAAGAATATACAGCATGG - Intergenic
978461805 4:108963184-108963206 GTGCATCACGATTTACAGAAGGG - Intronic
978509677 4:109502791-109502813 GTACTTCACAATATAGAGAAAGG - Intronic
979783289 4:124682991-124683013 ATCTATCAAAATATACATAAAGG - Intronic
979912898 4:126392479-126392501 GTACATCATAATCAACAGAATGG - Intergenic
980779264 4:137476319-137476341 GGCCTTCAGAATATATAGATGGG - Intergenic
984574644 4:181433965-181433987 TTTAATCAGAATATTCAGAATGG + Intergenic
984625781 4:182006310-182006332 TTCCACCAGAAAATACAAAAAGG - Intergenic
985987866 5:3532549-3532571 GTACCCCAGAATATACAGGAAGG - Intergenic
989266082 5:39475576-39475598 GTGTATCAGAATTTACAAAACGG + Intergenic
990420515 5:55627699-55627721 CTCCACCAGAACAAACAGAAAGG + Intronic
991248627 5:64534497-64534519 GACCAGCAGAATTTGCAGAAGGG + Intronic
993367806 5:87054384-87054406 GTCAATCAGAATATGCCTAAAGG - Intergenic
993494209 5:88588788-88588810 AACAATCAGAAGATACAGAATGG + Intergenic
994211833 5:97095575-97095597 GTCCCACAGTAAATACAGAAGGG + Intronic
995159116 5:108954878-108954900 GTCCATCAGAATATACAGAAAGG - Exonic
995262032 5:110115442-110115464 GTCTATCTAAATATAGAGAAGGG - Intergenic
995409273 5:111836333-111836355 GTAGATCTGAATATACAGAGAGG + Intronic
996340049 5:122427595-122427617 GTTCATCAAAATACACTGAATGG - Intronic
997740235 5:136246532-136246554 GCCCACCAGAATACACAGCATGG - Intronic
998964184 5:147520819-147520841 TTTCATCAGAATATTCAGACTGG + Intergenic
999353166 5:150896898-150896920 TTCCATCATAAGATACTGAAAGG - Exonic
1000614119 5:163409101-163409123 GTGCATCAGAATATTCTGGAGGG + Intergenic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1003693605 6:8379494-8379516 GACCTTCAGAAAATACATAAAGG + Intergenic
1004453471 6:15769443-15769465 AGGCATCAGAATATAAAGAAAGG + Intergenic
1004956905 6:20737232-20737254 GTCAAAAAGAATATGCAGAAAGG - Intronic
1005159449 6:22842241-22842263 GTACATGTGAATATACAGAGTGG + Intergenic
1005247444 6:23904419-23904441 GTCCATCAGAAATTCCAGAGAGG + Intergenic
1009793926 6:68441627-68441649 ATACATCAGATTATACAGATAGG + Intergenic
1010125159 6:72422700-72422722 ATCCAACTGAATATCCAGAAGGG - Intergenic
1010509169 6:76696737-76696759 TTCCATCAGAATATTCAATATGG + Intergenic
1010690452 6:78905451-78905473 GTGAATTAGAATATTCAGAAAGG + Intronic
1014156712 6:118119368-118119390 GTGCATCAAAATGTACACAATGG - Intronic
1014999845 6:128201446-128201468 GTACATCAGAATCTAAAAAAAGG + Intronic
1015182958 6:130380604-130380626 GTCCACCATCACATACAGAATGG - Intronic
1017318042 6:153055235-153055257 GTTTATCAGTAAATACAGAAGGG + Intronic
1020285250 7:6674216-6674238 GTCCATCAGAGTATTCACACAGG + Intergenic
1020768059 7:12350977-12350999 GTACATCAGAGTATTCAGTAAGG + Intronic
1021415414 7:20377999-20378021 TTCCATAAGAATATTCCGAATGG - Intronic
1022053388 7:26702508-26702530 GTCACTAAGAATATAGAGAAGGG - Intronic
1022303668 7:29126438-29126460 GACCATCAGAAGAGACAAAAAGG + Intronic
1023993981 7:45147360-45147382 GTCCATCTGACCATGCAGAAGGG + Intergenic
1027691527 7:81352909-81352931 CTCCATTAAAAGATACAGAATGG - Intergenic
1028718348 7:94000474-94000496 ATCATTCAGAATATACAGTAAGG + Intronic
1031514361 7:122683682-122683704 GTCCCTCAGCAAGTACAGAAGGG + Intronic
1031829061 7:126603618-126603640 TTCTAACAGAATATAGAGAAAGG + Intronic
1035977234 8:4325872-4325894 GACCATGTGCATATACAGAACGG - Intronic
1036030473 8:4965378-4965400 GTCAATCAAAATATTCAGATAGG - Intronic
1038633617 8:29268013-29268035 GACCATCAGAAACTACTGAATGG - Intergenic
1040321348 8:46307647-46307669 TTCCATCAGATTCTACAAAAAGG + Intergenic
1043119056 8:76299478-76299500 TTACCTCAGAATAGACAGAAAGG - Intergenic
1043766889 8:84146675-84146697 GAGGATCAGAATATATAGAAAGG - Intergenic
1044575124 8:93760094-93760116 GTCCTTTAAAATATACAGACTGG - Intronic
1045149320 8:99386050-99386072 CTCTAGCAGAATATAGAGAATGG + Intronic
1046328338 8:112679483-112679505 GTCCATCAGAAACTTCATAAGGG + Intronic
1047985445 8:130228399-130228421 GTGATTCAGAATATACACAATGG + Intronic
1050573675 9:6969325-6969347 GTCAATCAGAACATACAAAAAGG - Intronic
1054870309 9:70043151-70043173 GTGCATCAGAATCTGCTGAAGGG - Intergenic
1056291133 9:85144898-85144920 GTGCACCAGAATATACATTAAGG + Intergenic
1058963759 9:110017207-110017229 GTACAAAAGAATATACAGCATGG + Intronic
1059920517 9:119155337-119155359 GTACATATGAATATACAGAAAGG + Intronic
1185514715 X:690850-690872 GTCCTTCTGAAAATACAGACGGG - Intergenic
1186642679 X:11472864-11472886 CTCCAGCAGAATATAGACAATGG - Intronic
1186891019 X:13959300-13959322 GTGCATCAGAATAATCTGAAGGG + Intergenic
1188883980 X:35527395-35527417 GTCTATCAAATTTTACAGAAAGG + Intergenic
1190031904 X:46982096-46982118 GTTCATCAACATATACATAATGG - Intronic
1191609732 X:63100102-63100124 GTGCACCAGATTTTACAGAAAGG + Intergenic
1193898836 X:87149956-87149978 GTACATTAGGATATAAAGAAGGG - Intergenic
1194025132 X:88741866-88741888 GTCAATCAGACTTTACAAAAGGG - Intergenic
1196244523 X:113384732-113384754 GTGCATCAGAATATGCTGGAAGG + Intergenic
1196405051 X:115352431-115352453 GTCCATCACAATACACTGTAAGG + Intergenic
1198645758 X:138804277-138804299 GTCCATGAGAATAAAGTGAATGG - Intronic
1198915205 X:141663034-141663056 GTCCATCAGCATATGCAGTCTGG - Intronic
1199548319 X:149031609-149031631 GTGCATTGGAATATCCAGAAAGG - Intergenic
1200942387 Y:8798619-8798641 GTCCATCAGCATATGCAGCCTGG - Intergenic
1201983608 Y:19935906-19935928 GTACATGTGAATATAAAGAAAGG + Intergenic