ID: 995159117

View in Genome Browser
Species Human (GRCh38)
Location 5:108954883-108954905
Sequence CTGTATATTCTGATGGACAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995159114_995159117 -4 Left 995159114 5:108954864-108954886 CCTGGTGAATATGTCCTTTCTGT 0: 1
1: 0
2: 1
3: 18
4: 224
Right 995159117 5:108954883-108954905 CTGTATATTCTGATGGACAGAGG 0: 1
1: 0
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995159117 Original CRISPR CTGTATATTCTGATGGACAG AGG Exonic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
907741215 1:57167880-57167902 CTGGATATTTTGCTGGACACTGG - Intronic
909497406 1:76293706-76293728 CTTTATCTTCTAATTGACAGTGG - Intronic
910173867 1:84406970-84406992 CTATATTTTCTGCTAGACAGGGG + Intronic
910921429 1:92351880-92351902 CTTTGTATTCTGATGGTCTGTGG + Intronic
912524905 1:110274832-110274854 TTGTATATGGTGAGGGACAGGGG - Intronic
913796579 1:122626148-122626170 CTTCATATTCTGCTAGACAGAGG + Intergenic
913802117 1:122726092-122726114 CTTCATATTCTGCTAGACAGAGG + Intergenic
913811634 1:122897445-122897467 CTTCATATTCTGCTGGACAGAGG + Intergenic
913814166 1:122943014-122943036 CTTCATATTCTGCTAGACAGAGG + Intergenic
913824458 1:123127047-123127069 CTTCATATTCTGCTAGACAGAGG + Intergenic
913834167 1:123300884-123300906 CTTCATATACTGCTGGACAGAGG + Intergenic
913839954 1:123404034-123404056 CTTCATATTCTGCTAGACAGAGG + Intergenic
913841838 1:123437337-123437359 CTTCATATTCTGCTAGACAGAGG + Intergenic
913849079 1:123568696-123568718 CTTCATATTCTGCTAGACAGAGG + Intergenic
913857381 1:123717919-123717941 CTTCATATTCTGCTAGACAGAGG + Intergenic
913860060 1:123765677-123765699 CTTCATATTCTGCTAGACAGAGG + Intergenic
913870073 1:123945294-123945316 CTTCATATTCTGCTAGACAGAGG + Intergenic
913878732 1:124099942-124099964 CTTCATATTCTGCTAGACAGAGG + Intergenic
913886399 1:124237500-124237522 CTACATATTCTGCTAGACAGAGG + Intergenic
913911653 1:124690251-124690273 CTTCATATTCTGCTAGACAGAGG + Intergenic
919091455 1:192982751-192982773 CCATATATTCTCATCGACAGTGG + Intergenic
919350003 1:196439370-196439392 CTGTATTTTCTGTTGTACATTGG - Intronic
921270457 1:213464818-213464840 CTGCATATTTTTATGGATAGAGG + Intergenic
923263456 1:232289455-232289477 TTGTATATGCTGAGGGATAGGGG - Intergenic
1065843766 10:29728031-29728053 TGGTATATTCTCATGGACAGAGG + Intronic
1066693018 10:38050511-38050533 ATGTAAAGTCTGATGGACACTGG + Intronic
1068651215 10:59525130-59525152 TTAAATATTCTGCTGGACAGGGG + Intergenic
1068843373 10:61641181-61641203 CTGTATTTTTTTCTGGACAGCGG - Intergenic
1069776976 10:70933009-70933031 GTGTGTATTCTGATGCTCAGTGG - Intergenic
1071057369 10:81527428-81527450 CTGGATTTTCTGATTGACACTGG + Intergenic
1071377049 10:85017190-85017212 CTGTACATTTTGATGCAAAGAGG - Intergenic
1073288163 10:102400702-102400724 CTGGATCTGCTGGTGGACAGTGG + Exonic
1074061233 10:109967723-109967745 CTGTATATCCTGTTAGACTGAGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075683454 10:124348381-124348403 CTGTAAATTCTGGAGGGCAGGGG - Intergenic
1076415331 10:130283025-130283047 GTGGATTTTCTGATGTACAGTGG + Intergenic
1076496886 10:130903477-130903499 CTGTATTTCCAGCTGGACAGAGG - Intergenic
1077989587 11:7392278-7392300 TTGTATATTATGATAGATAGGGG + Intronic
1079936064 11:26617881-26617903 CTGTATATTCAGGTGATCAGAGG - Intronic
1081450923 11:43170095-43170117 CTGGATATTGTGATCCACAGTGG + Intergenic
1083733610 11:64667339-64667361 CTCTATCTTCTGCTGGACATGGG - Exonic
1085690319 11:78658943-78658965 CTGGATGTTCTGGTGGTCAGCGG - Intronic
1086931366 11:92696533-92696555 TGGTATATGCTGATGGACAATGG - Intronic
1087593169 11:100218609-100218631 CTGCATTTTCTTATGCACAGGGG + Intronic
1088560166 11:111106662-111106684 CTGTCTATACTGCTGGACACTGG - Intergenic
1088857813 11:113772303-113772325 CTGTTTAATGTGATGGAAAGAGG - Intronic
1088987441 11:114922101-114922123 CTGCATATGCTGAGGGAGAGAGG - Intergenic
1090009244 11:123031573-123031595 CTGTGTATGCTGATGGAGAGTGG + Intergenic
1092583583 12:9874704-9874726 CACTATATTATGATAGACAGTGG - Intergenic
1093090569 12:14915661-14915683 CTCTTTATTCTGGTGGACAGTGG - Exonic
1093760735 12:22906390-22906412 TTGTATATTCTGACAGATAGGGG - Intergenic
1093906589 12:24700374-24700396 CTCTATATTTTTAAGGACAGAGG + Intergenic
1094272021 12:28627410-28627432 CTGCATATTCTTATGCAGAGAGG + Intergenic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1094704712 12:32903308-32903330 CTGTATATATTGATGGATATAGG + Intergenic
1097226844 12:57481994-57482016 GTGGATTTTCTGGTGGACAGTGG - Intronic
1098674271 12:73268896-73268918 ATGTATATTCTGTTGTTCAGCGG - Intergenic
1099400556 12:82198422-82198444 TTGTATATGGTGATGGGCAGGGG - Intergenic
1103132541 12:118481721-118481743 CTGGTTAGTCTGATGGTCAGAGG + Intergenic
1103253265 12:119519248-119519270 CTGTATTTTCAGATGGCTAGGGG - Intronic
1105917239 13:24927825-24927847 CTGTGTATTCTTTTTGACAGAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107273246 13:38645314-38645336 CTGTATATTATGCTAGGCAGAGG - Intergenic
1108908676 13:55514250-55514272 CTGAATTTTCTGCTGGATAGGGG - Intergenic
1109451226 13:62517405-62517427 CTGTACCCTCTGATTGACAGTGG + Intergenic
1111251201 13:85603753-85603775 CTATATAATTTGATTGACAGTGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115629564 14:35230357-35230379 CTGTAAATTCTGATAGAGATGGG + Intronic
1118192084 14:63589979-63590001 TTGCATATTCTATTGGACAGTGG - Intergenic
1120530512 14:85625443-85625465 CTGCTTATTCTGAGGGACAAGGG - Exonic
1120637624 14:86971404-86971426 CTGTTTATTCTTATGGCCATTGG + Intergenic
1124361820 15:29042580-29042602 AAGTATATTCTGAGGTACAGGGG + Intronic
1124875869 15:33592693-33592715 CTGTACTTTCTGACTGACAGGGG - Intronic
1125126307 15:36226063-36226085 CTGTATATTGTGAAAGATAGTGG - Intergenic
1127032967 15:54884370-54884392 CTGTAGATTCTTATGGATGGGGG - Intergenic
1129546030 15:76396008-76396030 CTGTATATGGTGAGAGACAGGGG + Intronic
1129556608 15:76516759-76516781 TTCTATATCCTGAGGGACAGAGG + Intronic
1132087441 15:98919968-98919990 CTGTATGTTTTGAAGTACAGTGG + Intronic
1135492874 16:22925111-22925133 CTGTCTATTCAGTTGGTCAGAGG - Intergenic
1139355025 16:66362464-66362486 TGGTATATTCTGATGGACAGTGG - Intergenic
1141547998 16:84785248-84785270 CTGTGTCTTCTGATGGAAACAGG - Intergenic
1147424596 17:40340169-40340191 CTGGAAGTGCTGATGGACAGAGG - Intronic
1148208174 17:45792520-45792542 ATGTATATTCTGCTGGGTAGGGG - Intronic
1148915020 17:50969241-50969263 CTGTATATTCAGAAGCCCAGTGG + Intronic
1151287948 17:73127013-73127035 CTCAATTTTCTGATTGACAGAGG - Intergenic
1151882668 17:76904465-76904487 CTGGACATTCTTAAGGACAGTGG + Intronic
1153391856 18:4571154-4571176 CTGTATATGCTGAGAGATAGGGG + Intergenic
1154177024 18:12092499-12092521 CTGGATCTGCTGGTGGACAGTGG - Intergenic
1154376941 18:13818574-13818596 CTGTGAATTCTGCTGGGCAGAGG - Intergenic
1155979351 18:32164507-32164529 CTGGATTTTATGAAGGACAGAGG - Intronic
1156610853 18:38722521-38722543 ATGGATAGACTGATGGACAGAGG - Intergenic
1160171830 18:76561693-76561715 CTGTCCATTCTGTTGGCCAGAGG + Intergenic
1161059229 19:2206761-2206783 CTGTTTATTCTGAAGTTCAGAGG - Exonic
1165046109 19:33106338-33106360 CTAAATTTTCTGATGTACAGTGG + Intronic
1166425419 19:42674049-42674071 CTGTTTTTTCAGATGTACAGTGG + Intronic
1167283346 19:48584376-48584398 CGGGATCTTGTGATGGACAGGGG - Intronic
1167793931 19:51696960-51696982 CTGTAGATCCTCATAGACAGGGG + Intergenic
927282102 2:21317925-21317947 ATGTAGAGTCTGATGGACAGAGG + Intergenic
928236153 2:29542833-29542855 ATGTGTTTTCTGATTGACAGAGG - Intronic
928255935 2:29722716-29722738 CTGTGTATTCTGTTGTTCAGGGG - Intronic
931552177 2:63459043-63459065 CTGTATATTGTGAGAGATAGGGG - Intronic
937382008 2:121386947-121386969 CTGTATAATCTTATGCAAAGGGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
940928076 2:159390737-159390759 CTGAATATTATGATAGCCAGAGG + Intronic
942362203 2:175183823-175183845 CTGTGTTTTTTCATGGACAGTGG + Exonic
942732900 2:179078879-179078901 ATGTATATTCTGTTGAACTGGGG - Intergenic
948778610 2:240303267-240303289 CTGTATCTTCAGCTGGACTGTGG - Intergenic
1170695177 20:18651521-18651543 CAGTATATTCTGATAAAGAGAGG + Intronic
1177136359 21:17308769-17308791 CAGTTCATTCTGATGGAAAGGGG + Intergenic
1177464747 21:21461577-21461599 ATATATATTTTGATGAACAGTGG - Intronic
1180660330 22:17461644-17461666 CTGTGTATTCTGGTGCACAAAGG - Intronic
1180761469 22:18211792-18211814 ATGTATGTTCTGAAGGACATTGG - Intergenic
1180774198 22:18412818-18412840 ATGTATGTTCTGAAGGACATTGG + Intergenic
1180983061 22:19888385-19888407 CCATCTATTCTGATGGACACAGG + Intronic
1181070309 22:20331825-20331847 ATGTATGTTCTGAAGGACATTGG + Intergenic
1181193300 22:21159770-21159792 ATGTATGTTCTGAAGGACATTGG + Intergenic
1181216144 22:21332830-21332852 ATGTATGTTCTGAAGGACATTGG - Intergenic
950321408 3:12058004-12058026 ATGTAGATTCTGATGGAGAAGGG - Intronic
952067852 3:29593533-29593555 CTTTATATAGTGATGGACAAGGG + Intronic
954049050 3:47957841-47957863 CTGTATATTCTGATTGAGGGAGG - Intronic
954611056 3:51944766-51944788 CTCTATCTTCAGGTGGACAGAGG + Exonic
955224067 3:57046822-57046844 GTGTATATTCTGAAGGATACAGG - Intronic
957010995 3:75006343-75006365 CTGTATATTCTGTTGATCTGGGG + Intergenic
957686484 3:83509076-83509098 CTGAATATTCTGATGCCCAGTGG - Intergenic
959049961 3:101514908-101514930 CTGTATATTTTTGTGGAGAGGGG - Intergenic
959728353 3:109571408-109571430 CTCTATATTCTGGTAGACGGTGG - Intergenic
960455743 3:117869467-117869489 CTGTATATTATGAAGGCCTGAGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
966412682 3:179659151-179659173 TTGGAAACTCTGATGGACAGGGG + Intronic
970192926 4:13532226-13532248 CTGCAGATTCTTTTGGACAGAGG + Intergenic
971197783 4:24485990-24486012 CTGTTTACTCTGATAGACTGAGG + Intergenic
976064312 4:81166249-81166271 TTGTATATTGTGATTGACAGAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
977762384 4:100754746-100754768 CTGTATATGGTGATAGATAGGGG - Intronic
978844461 4:113255591-113255613 CTGTATATTCTGATGTCAAATGG + Intronic
979212893 4:118127364-118127386 TTGTATATGGTGATAGACAGGGG + Intronic
979335746 4:119459667-119459689 CTGTATATTAATTTGGACAGTGG - Intergenic
979963730 4:127052060-127052082 GTGTGTATCCTGATGGACAGAGG - Intergenic
982668615 4:158294648-158294670 CTGTATATTCTTTATGACAGAGG - Intergenic
983212288 4:164971240-164971262 ATCTATATACTGATGCACAGCGG + Intronic
983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG + Intronic
986344283 5:6820020-6820042 TTGCATTTTCTGATGGAGAGTGG + Intergenic
989156761 5:38351712-38351734 CTATGTATTCTGATTGTCAGGGG + Intronic
990530317 5:56667006-56667028 CTGGATATTCTGAAGTACAGAGG - Intergenic
990621412 5:57563527-57563549 CTTTGGAGTCTGATGGACAGAGG - Intergenic
992883206 5:81131002-81131024 CTATATATTTTGATGGAGATGGG - Intronic
995159117 5:108954883-108954905 CTGTATATTCTGATGGACAGAGG + Exonic
995540517 5:113181864-113181886 CTGTAAATTCTGAGGCCCAGGGG + Intronic
995938468 5:117548162-117548184 CTGTATATTCTTATGGGGACTGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997337367 5:133117719-133117741 CTGTAAATTCTGAAAGACAGGGG + Intergenic
997740236 5:136246537-136246559 CTGTGTATTCTGGTGGGCAGTGG + Intronic
1005488777 6:26326417-26326439 CTGTATATTCTGGAGCCCAGAGG + Intergenic
1006343384 6:33459927-33459949 CTGCATCTTCTGAAGGACAGAGG - Intergenic
1006468191 6:34208789-34208811 CTGTAGATTCTGCTAGACAGAGG + Intergenic
1007323966 6:41046377-41046399 CTATAAATACTGATGGACAGAGG + Intronic
1009898978 6:69788299-69788321 GTGTGTATTCTGATGTATAGAGG - Intronic
1010917182 6:81634629-81634651 CTGTATTTTTTTATGGTCAGAGG - Intronic
1011256622 6:85428473-85428495 CTGTATATTCTGTTGTTGAGTGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017662737 6:156689811-156689833 CTGTTTATTTTGTTGGCCAGAGG - Intergenic
1019063151 6:169272015-169272037 CTGTGTTTTCTTATGGATAGTGG - Intergenic
1021170245 7:17390889-17390911 CTGCATTTTCTGGTGGACAAAGG - Intergenic
1024241757 7:47440966-47440988 CTGGAGATATTGATGGACAGAGG - Intronic
1024505773 7:50159815-50159837 GTGTATATTCCGAAGGCCAGAGG - Exonic
1025824257 7:64997918-64997940 CTATCTATTATGATGAACAGGGG - Intronic
1027672930 7:81124585-81124607 CTGTATATTGTGAGAGATAGGGG + Intergenic
1028382894 7:90218439-90218461 TTGTATATGGTGAGGGACAGGGG + Intronic
1031189345 7:118527041-118527063 CTGTATATTCTGTTGTTTAGGGG - Intergenic
1032597851 7:133259932-133259954 CTGTATTTCCAGCTGGACAGTGG - Intronic
1034287154 7:149893606-149893628 ATGTCTATTCTGATAGCCAGCGG - Intergenic
1035251335 7:157599422-157599444 CTGTGTATTCAGAGAGACAGAGG - Intronic
1035670481 8:1413137-1413159 CTGTGTTTTCTACTGGACAGTGG + Intergenic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1041051075 8:53934786-53934808 CTGTATATTCTGTTGGTATGGGG - Intronic
1044173030 8:89080682-89080704 ATTTTCATTCTGATGGACAGTGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045233251 8:100326452-100326474 CTGTATACTGTGCTGGGCAGAGG + Intronic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1053078023 9:35151546-35151568 CTGTACATCCAGATGGACTGAGG - Intergenic
1054791003 9:69256661-69256683 CTGGACATTCTGAGGAACAGTGG - Intergenic
1058864475 9:109149002-109149024 CTGAATAATTTGATGGTCAGGGG - Intronic
1059103932 9:111495196-111495218 CTATATATGCTGATGGTCACTGG + Intergenic
1062116474 9:134811934-134811956 GTGTGTATTCTCATGCACAGAGG + Intronic
1203340582 Un_KI270311v1:11076-11098 CTTCATATTCTGTTAGACAGAGG + Intergenic
1188085453 X:25896834-25896856 CTGTGTATTCTTTTTGACAGAGG - Intergenic
1191773150 X:64784332-64784354 CTGTGTATTCTTTTTGACAGAGG + Intergenic
1191799686 X:65064608-65064630 ATGTATATTCTGTTGAACTGGGG + Intergenic
1193513392 X:82433346-82433368 CTGAATATTCTCATTGGCAGTGG + Intergenic
1193532626 X:82674660-82674682 CTGTCTTTTCACATGGACAGAGG + Intergenic
1194043160 X:88969053-88969075 CTGTATATACTTATGCACAGAGG - Intergenic
1197007942 X:121525682-121525704 CTGTACATGGTGATAGACAGGGG - Intergenic
1197364822 X:125550496-125550518 TTGTATATTGTGATAAACAGGGG - Intergenic
1197370130 X:125615965-125615987 CTGTTTGTTCTTATTGACAGTGG + Intergenic
1199373259 X:147076496-147076518 CTGTAGTTTCTGATGGTCATTGG + Intergenic
1199709699 X:150460480-150460502 CTTTAAAGTCTGAGGGACAGTGG + Intronic
1201054673 Y:9976725-9976747 CTGTGTATTCTTTAGGACAGAGG - Intergenic
1201520930 Y:14872864-14872886 CTGTGTATTCTTTTGAACAGAGG + Intergenic