ID: 995160698

View in Genome Browser
Species Human (GRCh38)
Location 5:108977500-108977522
Sequence TTCAAACCTATGTAGTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2312
Summary {0: 1, 1: 35, 2: 435, 3: 828, 4: 1013}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995160694_995160698 24 Left 995160694 5:108977453-108977475 CCAATGTATTTAATTTAAAAAGT 0: 1
1: 2
2: 11
3: 108
4: 908
Right 995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG 0: 1
1: 35
2: 435
3: 828
4: 1013
995160695_995160698 1 Left 995160695 5:108977476-108977498 CCATGTATAAGTGAATCCACACA 0: 1
1: 5
2: 18
3: 94
4: 405
Right 995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG 0: 1
1: 35
2: 435
3: 828
4: 1013

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995160698 Original CRISPR TTCAAACCTATGTAGTTCAA GGG Intronic
Too many off-targets to display for this crispr