ID: 995166776

View in Genome Browser
Species Human (GRCh38)
Location 5:109052752-109052774
Sequence GAGTAGTACTTACACTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995166774_995166776 26 Left 995166774 5:109052703-109052725 CCTGGATAATCTTATTTTAAGGT 0: 4
1: 33
2: 18
3: 70
4: 446
Right 995166776 5:109052752-109052774 GAGTAGTACTTACACTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995166776 Original CRISPR GAGTAGTACTTACACTCATA GGG Intronic
No off target data available for this crispr