ID: 995174973

View in Genome Browser
Species Human (GRCh38)
Location 5:109165761-109165783
Sequence TACATCCCATGTTCATTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995174973 Original CRISPR TACATCCCATGTTCATTCTA TGG Intronic
902484240 1:16732360-16732382 TGCAACCCATGTTCATTTTGGGG + Intergenic
902997473 1:20238041-20238063 TACAACCCATGTTCACTTTGGGG - Intergenic
904634142 1:31866716-31866738 TGCATCCCATGTTCACTTTGGGG - Intergenic
905288076 1:36898553-36898575 TACATCCCATGTTCATGGACTGG + Intronic
906630216 1:47361056-47361078 TACATCCCATGTTCATTTTGGGG + Intronic
907271042 1:53291314-53291336 TCCATCCCAAGCTCATTCCAGGG - Intronic
908469029 1:64423876-64423898 TACATCCCATGTTCCCTTTGGGG - Intergenic
909062221 1:70892284-70892306 TACCTCACATGTTCCTTCTAAGG + Intronic
910001499 1:82347969-82347991 TACACCCCAAGTTCATTCTGAGG - Intergenic
910124263 1:83822979-83823001 TGCATCCTTTGTACATTCTAAGG - Intergenic
911618966 1:100045122-100045144 CACATCCCATGTTCATGGAAGGG - Intronic
912009619 1:104943294-104943316 TAATTCACATGTTTATTCTAAGG - Intergenic
912144076 1:106770679-106770701 TACATCCAATTCTCATTTTAAGG + Intergenic
913060530 1:115201532-115201554 TACATCCCATGTTCATGTACTGG + Intergenic
914411882 1:147437216-147437238 TACACCCCATGTTCACTTTGGGG + Intergenic
915811975 1:158922787-158922809 TTCATCTCATGTTCATTGCATGG - Intergenic
915990474 1:160511099-160511121 TACATCCTATGTTCATTAATTGG + Intronic
918327569 1:183425063-183425085 CACAACCCATATTCCTTCTATGG + Intergenic
918598976 1:186330508-186330530 TACATCCCATGTTCACTTTGGGG - Intronic
919507477 1:198417402-198417424 AAAATCCCATGTTCTTTCTATGG + Intergenic
921889706 1:220341369-220341391 ATCATCCCATATTCATTCTGTGG - Intergenic
922979931 1:229817041-229817063 TACAACCCATGTTCACTTTGGGG + Intergenic
923037594 1:230295362-230295384 TACATCCCATGCTCATTTTGGGG + Intergenic
923065179 1:230510777-230510799 TACATCCCATGTTCACTTTGGGG + Intergenic
923249750 1:232168855-232168877 TACATCCCATGTTCACTTTGGGG - Intergenic
923423182 1:233841318-233841340 AACATCCCATGTTCATGAAATGG + Intergenic
923707340 1:236354847-236354869 TCCATCCCATGTTCACTTTGGGG - Intronic
923879592 1:238088846-238088868 TACATCCCATGCTCACTTTGGGG + Intergenic
1062775795 10:146488-146510 TACATCCCATGTTCATGGATTGG - Intronic
1062872879 10:921899-921921 TGCTTCCCATATTCATTCTTTGG + Intronic
1063237339 10:4130748-4130770 TACATCCCGTGTTCACTTTGGGG - Intergenic
1063403266 10:5768436-5768458 CACATCCCATGTTCATAGTTTGG + Intronic
1063497032 10:6519737-6519759 TACATCCCATGTTCACTTTGGGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064636480 10:17373323-17373345 TACATCCCATATTCACTTTGGGG - Intronic
1065417847 10:25508434-25508456 TATATTCTATGTTCATTTTAGGG + Intronic
1065766743 10:29037400-29037422 TACAACCCATGTTCACTTTCGGG + Intergenic
1067260715 10:44688456-44688478 TAAATCTCATAATCATTCTAGGG - Intergenic
1067773243 10:49142547-49142569 TACATCCCATGTTTACTTTGAGG + Intergenic
1068361522 10:55979595-55979617 TACATTTCATGTTCATTTCAAGG - Intergenic
1069234285 10:66050698-66050720 TACATTCCATATTCCTTCTCTGG + Intronic
1069273238 10:66557446-66557468 TATATACCATGTTCAGTCTCTGG + Intronic
1071239800 10:83692967-83692989 TACAACCCATGTCCATTTTAGGG + Intergenic
1071423371 10:85524404-85524426 TACATTCCATGTTCACTTTAGGG - Intergenic
1071926434 10:90415218-90415240 TATATCCAATTTTCTTTCTAGGG - Intergenic
1072000118 10:91186695-91186717 TACATCCCTAGTTGAATCTAGGG - Intronic
1073938909 10:108670737-108670759 TACAACCCATTTTAATTCTAGGG + Intergenic
1073961442 10:108934686-108934708 TACCTCCCAAGTTCATCCTAAGG - Intergenic
1074924168 10:118049909-118049931 TACATACCATGTTACTTCTTGGG - Intergenic
1075532582 10:123242369-123242391 TACATTCCATAGTGATTCTATGG + Intergenic
1079747040 11:24146627-24146649 AACATCCCATGCTCATGCTTAGG - Intergenic
1081185465 11:40036991-40037013 TACACCCCATGTTCACTTTGGGG + Intergenic
1084391203 11:68878335-68878357 TACATTCCATGTTCACTTTGGGG + Intergenic
1085145826 11:74196210-74196232 TATATGCCATTTTCATACTATGG - Intronic
1085214788 11:74819706-74819728 TAAATCCCATATTAATCCTATGG - Intronic
1086507905 11:87525041-87525063 TACATCACATGTTCACTTTGAGG + Intergenic
1086810997 11:91310012-91310034 TACATCTCATGGTAATTGTAAGG + Intergenic
1086827837 11:91521387-91521409 GACATGCCATGTTCATTGAATGG - Intergenic
1087089931 11:94258863-94258885 TACATCCCATGTTCATGAATTGG - Intergenic
1088180851 11:107108359-107108381 TACATCCCATGTTCATGGATTGG + Intergenic
1088386222 11:109259660-109259682 TACATCTCATGTTCATGCTTTGG - Intergenic
1094285213 12:28784756-28784778 TGCATCCCATGTTCACTTTGAGG - Intergenic
1094351464 12:29530512-29530534 TACATCCCATGTGCACTTTGAGG - Intronic
1096921380 12:55089898-55089920 TTGCTCCCATGTTCATGCTAAGG + Intergenic
1097751626 12:63360830-63360852 TACATCTCACATTCAGTCTAGGG + Intergenic
1098610740 12:72454228-72454250 TTTATCCCATTTTCATTATAAGG - Intronic
1098961290 12:76742159-76742181 TATATCTCATGTTCATTTTGGGG + Intergenic
1100710926 12:97256170-97256192 TACCCCACATATTCATTCTAGGG - Intergenic
1101913307 12:108877280-108877302 TACAACCCATGTTCACTTTGGGG - Intronic
1105839924 13:24245236-24245258 TACCACCCAGGTTCATTCCAGGG - Intronic
1107310024 13:39066814-39066836 TACATTCCATGTTCATTGATTGG - Intergenic
1108625352 13:52223331-52223353 TAAATTCCATGTTCATTCACAGG - Intergenic
1108660707 13:52583074-52583096 TAAATTCCATGTTCATTCACAGG + Intergenic
1109316996 13:60761583-60761605 AACATCCCATGTTCATGCCTAGG - Intergenic
1110544657 13:76743255-76743277 TACATTCCATGTTTATACTTGGG + Intergenic
1110600912 13:77372697-77372719 TACATCCCATGTTCACCTTGAGG - Intergenic
1110780055 13:79454988-79455010 TACATCCCATATTCACTTTGAGG + Intergenic
1111225970 13:85271294-85271316 TACATCCCATGTTCATATATGGG + Intergenic
1111311173 13:86488305-86488327 TACATTCCATGTTTATTGTGAGG + Intergenic
1111554496 13:89862570-89862592 TATACCCCATGTTCATTTTGGGG + Intergenic
1112549355 13:100404942-100404964 TACATCCAGTTTTCTTTCTAGGG + Intronic
1112608309 13:100929846-100929868 TACATCCCATGTTCACTTAGGGG + Intergenic
1113209289 13:107956448-107956470 TTCATCCTATCTTCATTTTATGG - Intergenic
1115187151 14:30701867-30701889 CTCATCTCATTTTCATTCTAGGG - Intronic
1115405304 14:33008718-33008740 TAAATCGCATGCCCATTCTATGG - Intronic
1116065685 14:39979930-39979952 CACATCACATGTTCATGCCAAGG + Intergenic
1116363268 14:44028456-44028478 TACATCTCATGTTCACTTTCAGG - Intergenic
1116435392 14:44890151-44890173 TGCATCCCATGTTCACTTTAGGG - Intergenic
1117625957 14:57638375-57638397 CACAACCCATGTTCACTCTGGGG - Intronic
1117769434 14:59118207-59118229 TACAACCCATGTTCACCCTGAGG - Intergenic
1118096954 14:62547340-62547362 TACTTCCAATATTCATTCAATGG - Intergenic
1118779893 14:69000778-69000800 TATATCTCATGTGCATTTTATGG + Intergenic
1119102556 14:71893730-71893752 TACATCACACGTTCATTTTGGGG + Intergenic
1119415693 14:74467882-74467904 TCCATCCCCTGTCCATCCTAAGG + Intergenic
1121016124 14:90550342-90550364 TGCATCCCATGTTCACTTTAGGG - Intronic
1121545152 14:94757788-94757810 CACATCTCATGGTCATTGTAGGG + Intergenic
1124122575 15:26902265-26902287 TAAATTCCATGTTCATTCATAGG - Intronic
1124989874 15:34661619-34661641 TACATACCATGTTCATGGTTTGG + Intergenic
1125002157 15:34782961-34782983 TACATCCCATGTTCACTTTGGGG - Intergenic
1125367824 15:38938122-38938144 CACATCCCATGCTCATGCTTGGG + Intergenic
1126056386 15:44733739-44733761 TACAACCCATGTTCACTTTGAGG - Intronic
1126504670 15:49390948-49390970 TTCATCCCATGGTCTTCCTAAGG - Intronic
1128783749 15:70379841-70379863 TATCTCCCAGGTTCCTTCTAGGG + Intergenic
1130935406 15:88466296-88466318 TACATCACATTTTGATTTTATGG - Intronic
1131766230 15:95678477-95678499 TAAATCCCATTTTCATTATTGGG + Intergenic
1132412956 15:101598828-101598850 TATATCCCATGTTCACTTTGGGG - Intergenic
1133913275 16:10085407-10085429 TACATGCCATGTTCATTTTGGGG + Intronic
1135020521 16:18959049-18959071 TACATCCCATGTTCACATTGGGG - Intergenic
1135296238 16:21281786-21281808 TACAACTCATGTTCATTTTGGGG - Intronic
1135601893 16:23790721-23790743 TACATCCCATGTTCACTTCGGGG - Intergenic
1135680827 16:24455267-24455289 TGCATCCCATGTTCACTCTGGGG + Intergenic
1136720738 16:32317846-32317868 CAGATCCCATGTTAATTGTAAGG + Intergenic
1136941347 16:34586620-34586642 TTCATTTCGTGTTCATTCTATGG - Intergenic
1137215909 16:46390224-46390246 TTCATTTCGTGTTCATTCTATGG - Intergenic
1137700484 16:50494429-50494451 TACATCCCATGTTCACCTTGGGG - Intergenic
1137998800 16:53251921-53251943 TACATCCCATGTTCATGGATGGG + Intronic
1141043910 16:80697919-80697941 TACATCCCATGTTCATGGATTGG + Intronic
1203005694 16_KI270728v1_random:199924-199946 CAGATCCCATGTTAATTGTAAGG - Intergenic
1146664620 17:34690213-34690235 TAACTCCCCTGTTAATTCTATGG + Intergenic
1147247804 17:39133508-39133530 TACTTCCTTTGTTCATTCAAAGG + Intronic
1150817569 17:68405311-68405333 TACATCCCATGTTCATGGATTGG - Intronic
1151360051 17:73583450-73583472 TGCATCCCATCTCTATTCTAAGG + Intronic
1153269100 18:3301715-3301737 TACATCCCATGCTCATGGTTTGG + Intergenic
1153566773 18:6426797-6426819 TACACCCCATGTTCACTTTGGGG + Intergenic
1153763069 18:8350296-8350318 TACATCCCATGTTCACTTTGGGG - Intronic
1154244770 18:12686434-12686456 TTTATCCCATTTTCATCCTAGGG + Exonic
1154343822 18:13526125-13526147 TATATCCCATATCCATCCTATGG - Intronic
1155406900 18:25498678-25498700 GACATCCCATGTTCATTGACTGG + Intergenic
1155590537 18:27422336-27422358 TACATCACATGTTCACTTTAGGG - Intergenic
1155840884 18:30641088-30641110 TACATCCTATGTTCATTCTGGGG - Intergenic
1156039760 18:32807350-32807372 TACATGCCATGTTCTTTGTGTGG - Intergenic
1156151794 18:34251778-34251800 TATGACCCATGTTCATTCTGGGG + Intergenic
1156827812 18:41453463-41453485 TACATCCCATGTTCATGAACTGG + Intergenic
1157752422 18:50191521-50191543 TACATTGCATGTTAATTCTTAGG - Intronic
1159502256 18:69288665-69288687 TATGTCCCATGTTCATGATAAGG + Intergenic
1163045136 19:14635743-14635765 TATATCCCATGTTCACTTTGGGG - Intronic
1164797929 19:31050621-31050643 AAAATCACATCTTCATTCTAAGG - Intergenic
925507421 2:4584071-4584093 GACAGCCCATGTTCATTTTCAGG + Intergenic
926471579 2:13266253-13266275 TACATTCCATGTTCATTTTGAGG - Intergenic
926758125 2:16252282-16252304 TTCAACCCAGTTTCATTCTAGGG - Intergenic
926766123 2:16324363-16324385 TATAGCAAATGTTCATTCTATGG - Intergenic
927658758 2:24973921-24973943 TACCTCCCAGGTCCATACTATGG - Intergenic
928244676 2:29616891-29616913 AACATCCCATGTTCACTTTGGGG - Intronic
928536830 2:32249276-32249298 TACAACCCATGTTCACTTTGGGG - Intronic
931459367 2:62436995-62437017 TACATCCCATGTTCACTCTGGGG + Intergenic
932265203 2:70361776-70361798 TACATAAAATGTGCATTCTACGG + Intergenic
933348922 2:81127928-81127950 TACTGCCAATGTTCCTTCTAGGG + Intergenic
934575485 2:95398011-95398033 TACAACCCATGTTCACTTTGGGG + Intergenic
936676755 2:114724599-114724621 TACTTCCCATGTTCACTTTGAGG + Intronic
937844344 2:126562884-126562906 TACATCCCATGTTCATGGTTTGG + Intergenic
938549635 2:132368291-132368313 TACATTCCATGTTCAGTTTGGGG - Intergenic
939835195 2:147121307-147121329 TGCATTCCATTTTCATTCAAAGG + Intergenic
940090807 2:149914860-149914882 TACATCTCAGGTTCATTTTCTGG - Intergenic
940570337 2:155424352-155424374 GACATCCCATGCTCTTCCTATGG - Intergenic
941425498 2:165339680-165339702 TATATGCCATGTTCATGCAATGG + Intronic
942988295 2:182167446-182167468 TACATCCCATGTTCATTTTGCGG - Intronic
943805511 2:192120386-192120408 TACATCCCATGTTCACTGTGGGG - Intronic
947197022 2:227578517-227578539 CCCATTCCATGTTCATTCCAAGG + Intergenic
1169406977 20:5329907-5329929 TGCATCCCATGTTCACTTTGAGG + Intergenic
1169532380 20:6499681-6499703 TACAGTCCATGTTCACTTTAGGG - Intergenic
1170720664 20:18875314-18875336 TACATCCCATGATCATGGAAGGG - Intergenic
1172171630 20:32938793-32938815 TACATCTCATGTTCATTGATTGG + Intronic
1172720011 20:36992719-36992741 TAGTTCACATGTTCATTCCAAGG + Intergenic
1172827992 20:37806618-37806640 CACATTCCATGTTCACTCTGGGG + Intronic
1172849931 20:37954245-37954267 TACATCCCATGTTCACTTTAGGG - Intergenic
1172945289 20:38682958-38682980 TACATCCCATGTTCACTTTGGGG + Intergenic
1173085386 20:39911144-39911166 TACATCCCCTCTTCATGCTTTGG - Intergenic
1173682457 20:44894761-44894783 TAGATGCCATCTTCATTTTATGG + Intronic
1174356238 20:49999877-49999899 TACATACCATGTATATTTTAGGG - Intergenic
1177172151 21:17666860-17666882 TACATTCCATGTTCACTTTGGGG + Intergenic
1179379173 21:40882432-40882454 TGCATCCCATGTTCACTTTGGGG + Intergenic
1180964808 22:19782275-19782297 TACATCCCATGTTCATGGATTGG - Intronic
1181014126 22:20058916-20058938 TACATCCCATGTTCACTTTGGGG + Intronic
1182684616 22:32112210-32112232 TACATCCCATCCCCATTCCAGGG + Exonic
1182752977 22:32656789-32656811 TACATCCCGTCTTCCTCCTACGG - Intronic
1183833783 22:40435285-40435307 TACCTCCCATGGTGATTATATGG - Intronic
1185412407 22:50690729-50690751 GACATCCCATGTTCATTAATTGG - Intergenic
949368508 3:3309088-3309110 TACAACCCATGTTCACTTTGGGG + Intergenic
949439311 3:4063447-4063469 TACATCCCATGTTCACTTTGGGG - Intronic
949909078 3:8885789-8885811 CACAACCCATGTTCATTCTGGGG + Intronic
951053575 3:18122102-18122124 TACATCCCCTGCTCATTGGAAGG + Intronic
951376549 3:21925026-21925048 TACATACCATGTTCATGGTTTGG + Intronic
952988463 3:38809630-38809652 TAAACCCCATGTTCAGTCTTTGG + Intergenic
957984161 3:87551165-87551187 TACACCCCATGTTCACTTTGGGG + Intergenic
958777362 3:98502359-98502381 TACTTCTCATGTTAATTCTCTGG - Intronic
960055800 3:113275534-113275556 TATATGCCATTTTCTTTCTAAGG + Intronic
960296440 3:115950613-115950635 TATATCCCATGTTCATTGTTGGG + Intronic
960468192 3:118025232-118025254 TACATCCCATGTTCATAGATTGG - Intergenic
961157847 3:124695956-124695978 TACATCCCCAGTTCCTTATATGG - Intronic
961251265 3:125508079-125508101 CACATCCCATGTTCATGATTTGG + Intronic
961870052 3:129980892-129980914 TACATCTCATGTTCACTTTGGGG + Intergenic
962651442 3:137497763-137497785 TATATCCCATGTTCATAGAATGG - Intergenic
963354091 3:144188534-144188556 CACAGCCCATATTCTTTCTATGG - Intergenic
966394507 3:179488306-179488328 TGCATCCCATGTTCACTGTGGGG - Intergenic
967505083 3:190244778-190244800 TACATTCCATGTTCAGTTTGGGG - Intergenic
970972932 4:22005865-22005887 TATATCCCATGTTCACTTTGGGG - Intergenic
971336641 4:25729318-25729340 TACATTCCATGTTCACTTTGGGG - Intergenic
972884244 4:43465617-43465639 TATATCCCATGTTCATGAAATGG - Intergenic
972912423 4:43833750-43833772 TACATCCCATGTTCATTTTGGGG - Intergenic
974264410 4:59565721-59565743 TACATCAAATGTTCTTTCTATGG + Intergenic
974790169 4:66678183-66678205 AACATCCCATGTTCATTGACTGG + Intergenic
975904587 4:79194289-79194311 AACATCCCATGCTCATGCAAAGG - Intergenic
975960890 4:79903198-79903220 TTCATTCCATCTTCAGTCTATGG + Intronic
976594556 4:86882744-86882766 TACTTCCCATGTTCACTTTGGGG - Intronic
981130707 4:141155632-141155654 TACATCCCATTTTCACTTTGGGG + Intronic
981461759 4:145020968-145020990 CACATCCCATGTTCATGGAATGG + Intronic
981461768 4:145021046-145021068 CACATCCCATGTTCATGGAATGG + Intronic
982792316 4:159607206-159607228 TACATCCCATGCTCACTTTGGGG - Intergenic
982854784 4:160366827-160366849 CAGGTGCCATGTTCATTCTAAGG - Intergenic
983323590 4:166226225-166226247 TACATCCCATGTTCACTTTGGGG + Intergenic
983544516 4:168948986-168949008 TACATCCCATGCTCATGGAAGGG - Intronic
984210985 4:176848046-176848068 TAAATGCCATGTTCATTTTCTGG + Intergenic
984408843 4:179369972-179369994 TACAACCCATGTTCATTTTGGGG + Intergenic
985183065 4:187286551-187286573 TACATCCCATGTTCACTTTGGGG + Intergenic
985424477 4:189815454-189815476 TACAACCCATGTTCCTGCTCAGG - Intergenic
986807873 5:11325985-11326007 CACATCCCATGTTCACTTTGTGG - Intronic
986946489 5:13028387-13028409 AATATCTCCTGTTCATTCTATGG + Intergenic
989589236 5:43098140-43098162 TACAGCCCATATTCATTCTGGGG - Intronic
990106908 5:52275585-52275607 TACATTTCATGTGCTTTCTAAGG - Intergenic
991724961 5:69526913-69526935 TACATCCCATGTTCACTTTGGGG + Intronic
993452287 5:88087016-88087038 CACATCCCCTGAACATTCTAAGG + Intergenic
993894661 5:93519267-93519289 TACATCTCACATTCATTCCAGGG + Intergenic
995174973 5:109165761-109165783 TACATCCCATGTTCATTCTATGG + Intronic
997662276 5:135598736-135598758 TACATCCCATTTTCACTTTGGGG + Intergenic
997663694 5:135609663-135609685 TACTTCCCATGATCCTTGTAAGG - Intergenic
997781060 5:136659010-136659032 TACATTCCAGGCTCATGCTAAGG + Intergenic
1000014284 5:157264205-157264227 TAAATCAGATTTTCATTCTAAGG - Intergenic
1001196447 5:169677473-169677495 TACATCCCATGTACACTTTGGGG - Intronic
1002768154 6:261688-261710 TAGATGCCAAGTTCATTCAAGGG - Intergenic
1003620990 6:7699726-7699748 TACATCCCATATTCACTTTGGGG - Intergenic
1005424465 6:25687308-25687330 GACATCCCATGTTCATACACTGG - Intronic
1006616321 6:35330016-35330038 TAAATCCCATGTTCACTTTGGGG + Intergenic
1007222415 6:40289562-40289584 TGCTACCCATGTTCATTCTTAGG + Intergenic
1009042575 6:58197112-58197134 TACATCCCTTTCTAATTCTAAGG - Intergenic
1009218413 6:60951340-60951362 TACATCCCTTTCTAATTCTAAGG - Intergenic
1009742393 6:67763217-67763239 TATATCCCATGTTCATGGTTTGG + Intergenic
1010340698 6:74749009-74749031 GAAAAGCCATGTTCATTCTAAGG - Intergenic
1010637391 6:78277840-78277862 TGCATCCCATGTTTATTCATTGG - Intergenic
1010964977 6:82194594-82194616 TACATCTCCTGTGTATTCTAGGG - Exonic
1011210176 6:84947021-84947043 TACATCCCATGTTCATGGATGGG - Intergenic
1011623251 6:89262281-89262303 TACAACCCATGTTCACCCTGGGG - Intronic
1011630745 6:89321606-89321628 TACGTCCCATTTTCATGTTAGGG + Intergenic
1011903713 6:92334184-92334206 TACATCCCATCCCCATTCCAGGG - Intergenic
1014507999 6:122282387-122282409 TACATCCCCTGTTCCTTGAAGGG + Intergenic
1015515684 6:134080542-134080564 TGCATCCCATGTTCACTTTGGGG - Intergenic
1016054711 6:139566697-139566719 TACCACCCATGTTCACTCAAGGG + Intergenic
1017634479 6:156430591-156430613 TATCCCCCATGTTCACTCTAAGG - Intergenic
1020083250 7:5297535-5297557 GACAGCCCACGTTCATTCTGAGG + Intronic
1021014373 7:15514385-15514407 TAAATACCATATTCATACTACGG - Intronic
1021254129 7:18368828-18368850 TACAACCCCTGTTCCTTCTCAGG - Intronic
1022334959 7:29413510-29413532 TACATGTAATGTTCTTTCTAGGG - Intronic
1023509871 7:40940501-40940523 TACATCCCATGCTCACGGTATGG - Intergenic
1024127390 7:46314102-46314124 AACATCCCATGTTCATTGATTGG - Intergenic
1025032499 7:55569352-55569374 TAAATCACATGGTCTTTCTAAGG + Intronic
1026140119 7:67698602-67698624 TACATCCCATGTTCACTGTGGGG + Intergenic
1028788661 7:94827222-94827244 TACATCCCATGTTCATTTGGGGG + Intergenic
1030429769 7:109430327-109430349 TAGATGACATGTTCATTCTTGGG + Intergenic
1031881970 7:127208223-127208245 TGCATCCCATGTTCACTTTGGGG - Intronic
1033121038 7:138666760-138666782 TACATCACATGTTCACTTTGGGG - Intronic
1036741257 8:11363775-11363797 TACCTTCCATATTCATTCTCAGG - Intergenic
1036922346 8:12869505-12869527 TACATTCTCTGTTCATTTTAGGG - Intergenic
1037404425 8:18526314-18526336 TACACCCTACGTTCATTTTAGGG - Intergenic
1038032731 8:23658260-23658282 AACATCCCATGTTCATGGAATGG - Intergenic
1038369224 8:26970801-26970823 TTCGTCCCATGATAATTCTATGG - Intergenic
1038784754 8:30601966-30601988 TCCATTCCATTTACATTCTAGGG + Intronic
1040586177 8:48744254-48744276 TAGATCCTATGTTCATTGAAAGG - Intergenic
1040678773 8:49784116-49784138 TACAACCCATGTTCATTTTGGGG - Intergenic
1040974444 8:53174562-53174584 TACATTCCATGTTCACTTTGGGG + Intergenic
1041553674 8:59128728-59128750 GACATGCCGTGTTCATTGTATGG + Intergenic
1043507546 8:80917290-80917312 TACATCCCACGTTCACTTTGAGG + Intergenic
1043536624 8:81212258-81212280 TACTTCCTATTTTCATTATAGGG - Intergenic
1043541682 8:81270276-81270298 TATATCCCATGTTCACTTTGGGG + Intergenic
1044818692 8:96140166-96140188 TATATCCCATTTTCTTTTTAAGG - Intergenic
1046244833 8:111545605-111545627 TACATTGCATGTTCACTCTGGGG - Intergenic
1047613276 8:126541756-126541778 TGGATCACATGTTAATTCTATGG - Intergenic
1048663803 8:136637525-136637547 TACATCCCATGTTCATGGATAGG - Intergenic
1049975789 9:860496-860518 TTCAACAAATGTTCATTCTATGG + Intronic
1050002495 9:1093065-1093087 TACAACCCATGTTCACTTTGAGG + Intergenic
1050045798 9:1543903-1543925 TACATCCCATGCTCATGCATTGG - Intergenic
1050867194 9:10517188-10517210 TACATCCCATGTTCATGAATTGG - Intronic
1050888418 9:10793743-10793765 CACATCCCATGTTCATTGATTGG - Intergenic
1051341869 9:16119586-16119608 TACATCCCATGTTCACTTTGGGG - Intergenic
1052785453 9:32824033-32824055 TACATCGCATGTTCACTTTGGGG - Intergenic
1053118804 9:35529741-35529763 TACACACCATGCTCATTCTGAGG - Intronic
1054802766 9:69367476-69367498 TACATCCCATGTTCATGGATTGG - Intronic
1055084589 9:72301112-72301134 TTCAGCCCAGGTTCAGTCTATGG - Intergenic
1056104866 9:83337059-83337081 TGCATCCCATGTTCACTTTTGGG - Intronic
1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG + Intronic
1056493468 9:87131794-87131816 GACATCCCATGGTCATTGAATGG + Intergenic
1056565388 9:87767972-87767994 TACATCCTATGTTCATTTATAGG - Intergenic
1057318908 9:93994017-93994039 TACATTCCATGTTCACTTTGGGG + Intergenic
1186625522 X:11289265-11289287 TATATCCAATGTTCATTCTTAGG - Intronic
1186943811 X:14542319-14542341 TACAACCCATGTTCACTTTGAGG + Intronic
1187657076 X:21488485-21488507 TCAAGCCCATGTTCTTTCTATGG + Intronic
1188811822 X:34660391-34660413 AACATCCCATGTTCACTTTGGGG + Intergenic
1188986473 X:36772769-36772791 TACATTCCATGCACATCCTAAGG + Intergenic
1189365578 X:40385413-40385435 TAGAGCCCATATTCTTTCTACGG + Intergenic
1189689661 X:43602764-43602786 TACAACCCAAGTTCATGTTAGGG + Intergenic
1190490474 X:50978073-50978095 AACATCCCATGCTCATTGTTGGG + Intergenic
1190871755 X:54430635-54430657 TCCATCCAAGGTTCATTCTAAGG + Intergenic
1192740130 X:73884135-73884157 TACATCTCATGTTCTTTGCAGGG + Intergenic
1192804913 X:74500053-74500075 TACATCCCAAGTTCACTTTGGGG + Intronic
1193404013 X:81080443-81080465 TACATCCCATGATCATTAATTGG + Intergenic
1194178713 X:90687308-90687330 TATATCCCATGTTCATGCACTGG + Intergenic
1194790110 X:98137493-98137515 TACATCCCATGTTCATGAATGGG + Intergenic
1195385486 X:104310031-104310053 TACTTCCCAGGTTCACTCTGAGG + Intergenic
1196110403 X:111941014-111941036 TACAACCCATGTTCATTTTAGGG - Intronic
1196311043 X:114165991-114166013 AACATACCATATTCATTTTATGG + Intergenic
1196750329 X:119110815-119110837 GAAATCCCATGTTCATTCATTGG + Intronic
1197643143 X:128988494-128988516 TACATCCCATGTTCATGGATTGG - Intergenic
1197988375 X:132291272-132291294 TACATCCCATGCTCATGCACTGG - Intergenic
1198320406 X:135514121-135514143 TACACCCCATGTTCAGTCAATGG + Intergenic
1199158709 X:144581794-144581816 TACATCCCATGTTCATGGATTGG - Intergenic
1199787121 X:151115561-151115583 TACCTCACAGGTTCATTGTAAGG - Intergenic
1200299811 X:154962031-154962053 TACATTCCATGTTCACTTTGGGG - Intronic
1201930271 Y:19337188-19337210 TACATCCCATGCTCATGCGTAGG + Intergenic