ID: 995181129

View in Genome Browser
Species Human (GRCh38)
Location 5:109231246-109231268
Sequence GGCAGACCACCATGCGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995181129_995181136 10 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181136 5:109231279-109231301 GCTACTTGGGAGACTGAGGTGGG 0: 729
1: 17559
2: 112964
3: 213923
4: 267405
995181129_995181131 -3 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181131 5:109231266-109231288 GCCTGTAATCCTAGCTACTTGGG 0: 1673
1: 43580
2: 172256
3: 282952
4: 461973
995181129_995181134 6 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181134 5:109231275-109231297 CCTAGCTACTTGGGAGACTGAGG 0: 260
1: 9357
2: 110706
3: 220923
4: 259452
995181129_995181130 -4 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181130 5:109231265-109231287 TGCCTGTAATCCTAGCTACTTGG 0: 2326
1: 58056
2: 108028
3: 166166
4: 245532
995181129_995181138 30 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181138 5:109231299-109231321 GGGAGGATTGCTTGAGTTTGAGG No data
995181129_995181137 13 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181137 5:109231282-109231304 ACTTGGGAGACTGAGGTGGGAGG 0: 523
1: 9764
2: 23496
3: 70703
4: 134195
995181129_995181135 9 Left 995181129 5:109231246-109231268 CCTGCTGCGCATGGTGGTCTGCC No data
Right 995181135 5:109231278-109231300 AGCTACTTGGGAGACTGAGGTGG 0: 739
1: 14609
2: 30103
3: 46294
4: 113613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995181129 Original CRISPR GGCAGACCACCATGCGCAGC AGG (reversed) Intergenic
No off target data available for this crispr