ID: 995182438

View in Genome Browser
Species Human (GRCh38)
Location 5:109241406-109241428
Sequence GAAATGGAGGAGTAGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182438_995182447 20 Left 995182438 5:109241406-109241428 CCTCCCCTCTACTCCTCCATTTC No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182438_995182446 0 Left 995182438 5:109241406-109241428 CCTCCCCTCTACTCCTCCATTTC No data
Right 995182446 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
995182438_995182448 25 Left 995182438 5:109241406-109241428 CCTCCCCTCTACTCCTCCATTTC No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182438 Original CRISPR GAAATGGAGGAGTAGAGGGG AGG (reversed) Intergenic
No off target data available for this crispr