ID: 995182440

View in Genome Browser
Species Human (GRCh38)
Location 5:109241410-109241432
Sequence AAGGGAAATGGAGGAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182440_995182447 16 Left 995182440 5:109241410-109241432 CCCTCTACTCCTCCATTTCCCTT No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182440_995182448 21 Left 995182440 5:109241410-109241432 CCCTCTACTCCTCCATTTCCCTT No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182440_995182446 -4 Left 995182440 5:109241410-109241432 CCCTCTACTCCTCCATTTCCCTT No data
Right 995182446 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182440 Original CRISPR AAGGGAAATGGAGGAGTAGA GGG (reversed) Intergenic
No off target data available for this crispr