ID: 995182443

View in Genome Browser
Species Human (GRCh38)
Location 5:109241422-109241444
Sequence TAGCAGCACTACAAGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182443_995182448 9 Left 995182443 5:109241422-109241444 CCATTTCCCTTGTAGTGCTGCTA No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182443_995182447 4 Left 995182443 5:109241422-109241444 CCATTTCCCTTGTAGTGCTGCTA No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182443 Original CRISPR TAGCAGCACTACAAGGGAAA TGG (reversed) Intergenic
No off target data available for this crispr