ID: 995182445

View in Genome Browser
Species Human (GRCh38)
Location 5:109241429-109241451
Sequence CCATCATTAGCAGCACTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182445_995182448 2 Left 995182445 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182445_995182447 -3 Left 995182445 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182445_995182450 27 Left 995182445 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
Right 995182450 5:109241479-109241501 GATTTGCAAACTCAGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182445 Original CRISPR CCATCATTAGCAGCACTACA AGG (reversed) Intergenic