ID: 995182445 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:109241429-109241451 |
Sequence | CCATCATTAGCAGCACTACA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
995182445_995182448 | 2 | Left | 995182445 | 5:109241429-109241451 | CCTTGTAGTGCTGCTAATGATGG | No data | ||
Right | 995182448 | 5:109241454-109241476 | TAGTTCGCCATCAGTTGGTAAGG | No data | ||||
995182445_995182447 | -3 | Left | 995182445 | 5:109241429-109241451 | CCTTGTAGTGCTGCTAATGATGG | No data | ||
Right | 995182447 | 5:109241449-109241471 | TGGTATAGTTCGCCATCAGTTGG | No data | ||||
995182445_995182450 | 27 | Left | 995182445 | 5:109241429-109241451 | CCTTGTAGTGCTGCTAATGATGG | No data | ||
Right | 995182450 | 5:109241479-109241501 | GATTTGCAAACTCAGCCCTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
995182445 | Original CRISPR | CCATCATTAGCAGCACTACA AGG (reversed) | Intergenic | ||