ID: 995182447

View in Genome Browser
Species Human (GRCh38)
Location 5:109241449-109241471
Sequence TGGTATAGTTCGCCATCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182444_995182447 -2 Left 995182444 5:109241428-109241450 CCCTTGTAGTGCTGCTAATGATG No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182440_995182447 16 Left 995182440 5:109241410-109241432 CCCTCTACTCCTCCATTTCCCTT No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182441_995182447 15 Left 995182441 5:109241411-109241433 CCTCTACTCCTCCATTTCCCTTG No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182442_995182447 7 Left 995182442 5:109241419-109241441 CCTCCATTTCCCTTGTAGTGCTG No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182443_995182447 4 Left 995182443 5:109241422-109241444 CCATTTCCCTTGTAGTGCTGCTA No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182445_995182447 -3 Left 995182445 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182437_995182447 26 Left 995182437 5:109241400-109241422 CCTTCTCCTCCCCTCTACTCCTC No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182439_995182447 17 Left 995182439 5:109241409-109241431 CCCCTCTACTCCTCCATTTCCCT No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data
995182438_995182447 20 Left 995182438 5:109241406-109241428 CCTCCCCTCTACTCCTCCATTTC No data
Right 995182447 5:109241449-109241471 TGGTATAGTTCGCCATCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182447 Original CRISPR TGGTATAGTTCGCCATCAGT TGG Intergenic
No off target data available for this crispr