ID: 995182448

View in Genome Browser
Species Human (GRCh38)
Location 5:109241454-109241476
Sequence TAGTTCGCCATCAGTTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182444_995182448 3 Left 995182444 5:109241428-109241450 CCCTTGTAGTGCTGCTAATGATG No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182439_995182448 22 Left 995182439 5:109241409-109241431 CCCCTCTACTCCTCCATTTCCCT No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182443_995182448 9 Left 995182443 5:109241422-109241444 CCATTTCCCTTGTAGTGCTGCTA No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182438_995182448 25 Left 995182438 5:109241406-109241428 CCTCCCCTCTACTCCTCCATTTC No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182441_995182448 20 Left 995182441 5:109241411-109241433 CCTCTACTCCTCCATTTCCCTTG No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182442_995182448 12 Left 995182442 5:109241419-109241441 CCTCCATTTCCCTTGTAGTGCTG No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182440_995182448 21 Left 995182440 5:109241410-109241432 CCCTCTACTCCTCCATTTCCCTT No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data
995182445_995182448 2 Left 995182445 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
Right 995182448 5:109241454-109241476 TAGTTCGCCATCAGTTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182448 Original CRISPR TAGTTCGCCATCAGTTGGTA AGG Intergenic
No off target data available for this crispr