ID: 995182450

View in Genome Browser
Species Human (GRCh38)
Location 5:109241479-109241501
Sequence GATTTGCAAACTCAGCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995182444_995182450 28 Left 995182444 5:109241428-109241450 CCCTTGTAGTGCTGCTAATGATG No data
Right 995182450 5:109241479-109241501 GATTTGCAAACTCAGCCCTCAGG No data
995182449_995182450 -5 Left 995182449 5:109241461-109241483 CCATCAGTTGGTAAGGTTGATTT No data
Right 995182450 5:109241479-109241501 GATTTGCAAACTCAGCCCTCAGG No data
995182445_995182450 27 Left 995182445 5:109241429-109241451 CCTTGTAGTGCTGCTAATGATGG No data
Right 995182450 5:109241479-109241501 GATTTGCAAACTCAGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995182450 Original CRISPR GATTTGCAAACTCAGCCCTC AGG Intergenic
No off target data available for this crispr