ID: 995183084

View in Genome Browser
Species Human (GRCh38)
Location 5:109247004-109247026
Sequence ATGCCCTGCCAACCCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995183084_995183086 -5 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183086 5:109247022-109247044 GGCATCCCTGAGCCAGCCAGTGG No data
995183084_995183091 1 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183091 5:109247028-109247050 CCTGAGCCAGCCAGTGGGGATGG No data
995183084_995183088 -3 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183088 5:109247024-109247046 CATCCCTGAGCCAGCCAGTGGGG No data
995183084_995183097 22 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183097 5:109247049-109247071 GGAGTAAACTGGGACAGGCCTGG No data
995183084_995183087 -4 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183087 5:109247023-109247045 GCATCCCTGAGCCAGCCAGTGGG No data
995183084_995183094 11 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183094 5:109247038-109247060 CCAGTGGGGATGGAGTAAACTGG No data
995183084_995183095 12 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG No data
995183084_995183096 17 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183096 5:109247044-109247066 GGGATGGAGTAAACTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995183084 Original CRISPR ATGCCCTGCCAACCCCACCA GGG (reversed) Intergenic
No off target data available for this crispr