ID: 995183095

View in Genome Browser
Species Human (GRCh38)
Location 5:109247039-109247061
Sequence CAGTGGGGATGGAGTAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995183085_995183095 11 Left 995183085 5:109247005-109247027 CCTGGTGGGGTTGGCAGGGCATC No data
Right 995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG No data
995183084_995183095 12 Left 995183084 5:109247004-109247026 CCCTGGTGGGGTTGGCAGGGCAT No data
Right 995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995183095 Original CRISPR CAGTGGGGATGGAGTAAACT GGG Intergenic
No off target data available for this crispr