ID: 995187265

View in Genome Browser
Species Human (GRCh38)
Location 5:109285033-109285055
Sequence CAGCAAAAAGCAGTGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995187261_995187265 27 Left 995187261 5:109284983-109285005 CCTTGAAATGAATGATACTAGTG No data
Right 995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995187265 Original CRISPR CAGCAAAAAGCAGTGCTAGA AGG Intergenic
No off target data available for this crispr