ID: 995188666

View in Genome Browser
Species Human (GRCh38)
Location 5:109298020-109298042
Sequence GAAGCATCATGAACCCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995188666_995188667 -10 Left 995188666 5:109298020-109298042 CCGTGCAGGGTTCATGATGCTTC No data
Right 995188667 5:109298033-109298055 ATGATGCTTCTGACACTTTCTGG No data
995188666_995188668 5 Left 995188666 5:109298020-109298042 CCGTGCAGGGTTCATGATGCTTC No data
Right 995188668 5:109298048-109298070 CTTTCTGGTCCATGAAGCCCTGG No data
995188666_995188669 11 Left 995188666 5:109298020-109298042 CCGTGCAGGGTTCATGATGCTTC No data
Right 995188669 5:109298054-109298076 GGTCCATGAAGCCCTGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995188666 Original CRISPR GAAGCATCATGAACCCTGCA CGG (reversed) Intergenic
No off target data available for this crispr