ID: 995191308

View in Genome Browser
Species Human (GRCh38)
Location 5:109321749-109321771
Sequence ACAAACTAAACAATAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995191308_995191309 -2 Left 995191308 5:109321749-109321771 CCTTTCATTATTGTTTAGTTTGT No data
Right 995191309 5:109321770-109321792 GTTGCACAAATTGTCCCGTTTGG No data
995191308_995191311 8 Left 995191308 5:109321749-109321771 CCTTTCATTATTGTTTAGTTTGT No data
Right 995191311 5:109321780-109321802 TTGTCCCGTTTGGCCAGTAAGGG No data
995191308_995191310 7 Left 995191308 5:109321749-109321771 CCTTTCATTATTGTTTAGTTTGT No data
Right 995191310 5:109321779-109321801 ATTGTCCCGTTTGGCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995191308 Original CRISPR ACAAACTAAACAATAATGAA AGG (reversed) Intergenic
No off target data available for this crispr