ID: 995199241

View in Genome Browser
Species Human (GRCh38)
Location 5:109409224-109409246
Sequence GGCGGAAAGGTGCTGATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995199234_995199241 5 Left 995199234 5:109409196-109409218 CCTGACATCGCTAACTGAGAGCA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 995199241 5:109409224-109409246 GGCGGAAAGGTGCTGATCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995199241 Original CRISPR GGCGGAAAGGTGCTGATCCC GGG Intronic
900165370 1:1242351-1242373 GGCAGAAGGGTGCTGTTCACAGG - Intergenic
900391310 1:2435197-2435219 GGAGGAAAGGTCCTCACCCCCGG - Intronic
901922162 1:12545105-12545127 AGCGGAAAGGTCATGGTCCCTGG + Intergenic
906382727 1:45343027-45343049 GGAGGGAAGGTTCTGATGCCTGG + Intronic
907985314 1:59524369-59524391 GGCAGAAAGGAGCGGGTCCCTGG + Intronic
908966962 1:69777172-69777194 GGAGGAATGGGGCAGATCCCGGG + Intronic
909907815 1:81221019-81221041 GGCAGAAAGGGGCGGGTCCCTGG + Intergenic
910259845 1:85284233-85284255 GGCAGAAAGGGGCAGGTCCCTGG + Intergenic
910739010 1:90494799-90494821 GGGGGAAAGCTGGTGGTCCCAGG + Intergenic
914755825 1:150561195-150561217 AGCGGAAAGGCGCAGATACCCGG - Intergenic
915595333 1:156893681-156893703 GGCGGGACGCTGCTGATCGCAGG - Intronic
915971055 1:160355594-160355616 GGAGGAAAGGGGCAGAGCCCTGG + Intronic
916297708 1:163237960-163237982 GGCAGAAAGATGCTGAACACAGG + Intronic
917183218 1:172322150-172322172 AGCGGAAAGGTAATGATCCCAGG - Intronic
917977292 1:180248400-180248422 GGCGGACAGGTGCTTCTCCAGGG + Exonic
919786190 1:201259971-201259993 GGGGGACAGGTGCTGCTCCAGGG - Intergenic
919795010 1:201316378-201316400 GGAGGAGAGGAGCTGTTCCCAGG + Intronic
920585292 1:207153239-207153261 GGGGAAAAGGTGCTTATCACGGG - Intergenic
923552178 1:234972908-234972930 GGTGGAATGGCTCTGATCCCAGG + Intergenic
1065593286 10:27287433-27287455 TGTGGAGAGGTGCTGAACCCAGG - Intergenic
1065657089 10:27962854-27962876 TGTGGAGAGGTGCTGAACCCAGG + Intronic
1067794439 10:49310451-49310473 GGTGGTAAGGTGGTGAGCCCAGG + Intronic
1068137534 10:52965494-52965516 GGTGGAAAGGGGCGGGTCCCTGG - Intergenic
1069561793 10:69435921-69435943 GGTGGAAAGGGGCAGGTCCCTGG - Intergenic
1073177147 10:101563594-101563616 GGCTGAAAGATGCTCGTCCCTGG - Intergenic
1073562312 10:104507370-104507392 GGCAGATAGTTTCTGATCCCAGG - Intergenic
1074301836 10:112240449-112240471 GGCAGAAAGGGGCGGGTCCCTGG - Intergenic
1076131531 10:128017191-128017213 GGCTGAGAGGTGCTGGTCCCTGG + Intronic
1077296625 11:1829451-1829473 GGTGTAAAGATGCTGATGCCAGG + Intronic
1078018301 11:7634134-7634156 AGGGGAAAGGTGCTGATGCTGGG - Intronic
1078894595 11:15586833-15586855 GGGGAAGAGGTGCTGATCACAGG - Intergenic
1079184142 11:18221260-18221282 GGCAGAAAGGCGCAGGTCCCTGG - Intronic
1079356593 11:19735092-19735114 GTCTGTAAGGTGCTGAGCCCAGG + Intronic
1080540219 11:33257746-33257768 CGCGGAGAGGGGCTGAGCCCGGG + Exonic
1082576131 11:54806215-54806237 GGCGAAAAGGTGAATATCCCAGG - Intergenic
1082587307 11:54957059-54957081 GGCGAAAAGGTGAAAATCCCAGG + Intergenic
1083716689 11:64581502-64581524 GCCTGAAGGCTGCTGATCCCTGG - Intergenic
1084756418 11:71241672-71241694 TGAGGCAAGGTGCTGCTCCCTGG - Intronic
1088590059 11:111395458-111395480 GGGGTGACGGTGCTGATCCCAGG - Intronic
1090728413 11:129548407-129548429 GGCAGATAGGGGCAGATCCCTGG + Intergenic
1095749702 12:45696989-45697011 GGCGGAAAGGGGCAGGTCCCTGG - Intergenic
1098790554 12:74816860-74816882 GGTGGAAAGGGGCAGATCCCTGG + Intergenic
1101606407 12:106249920-106249942 GGCGGAAATGGGGTGAGCCCAGG + Intronic
1101901923 12:108797369-108797391 GGCAGACAGGTGCGGGTCCCTGG + Intronic
1102012206 12:109625698-109625720 GGTGGACAGGTGCTGTGCCCTGG - Intergenic
1103899668 12:124296643-124296665 AGCGGAAAGGAGCGGCTCCCCGG + Intronic
1108018142 13:46097353-46097375 TGAGGAATGGTGCTGATTCCGGG - Intronic
1108542442 13:51456537-51456559 GGCGGAAAGGGGTGGGTCCCCGG - Intergenic
1109470627 13:62799444-62799466 GGTGGAAAGGGGCGGGTCCCGGG + Intergenic
1109771927 13:66986155-66986177 GAAGGAAAAGTGCTGATCCAAGG + Intronic
1110201138 13:72851609-72851631 GGCGGAAAGGGGTGGGTCCCTGG + Intronic
1111243714 13:85508237-85508259 GGCAGAAAGGGGTGGATCCCTGG + Intergenic
1113049852 13:106198969-106198991 GACGGACAGGTGGTGATGCCAGG + Intergenic
1113561316 13:111283645-111283667 GCTGGAAAGGCGCTGAGCCCAGG + Intronic
1113603168 13:111585722-111585744 GGCTGACAGGTGCTGTGCCCAGG + Intergenic
1114650073 14:24279201-24279223 TTCTGAAAGATGCTGATCCCTGG + Intergenic
1117938387 14:60934354-60934376 GGTGTAAAGGTGCAGATACCAGG - Intronic
1119257201 14:73208798-73208820 GGCGGAAAGGGGAAGTTCCCTGG - Intronic
1119376039 14:74194123-74194145 TGGGGAAAGGTGCAGAGCCCTGG + Intronic
1119514952 14:75240703-75240725 GCTGGAAAGATGCTGATCCATGG - Intronic
1122519813 14:102335393-102335415 GGCAGAAAGGCCCTGAGCCCCGG - Intronic
1126855635 15:52836848-52836870 GGCCTAAAAGTGCTGATTCCTGG + Intergenic
1130134282 15:81169107-81169129 GGCAGACAGGGGCAGATCCCTGG + Intronic
1130809914 15:87365939-87365961 GGCAGACAGGTGCTGTTCTCTGG - Intergenic
1131154029 15:90063826-90063848 GGCGGGAGGGGGCTGATTCCTGG + Intronic
1135062979 16:19286498-19286520 GGCTGACAGGTTCTCATCCCTGG - Intronic
1139472257 16:67184538-67184560 CGCGGCCAGGTGCTGCTCCCGGG + Exonic
1142130792 16:88430674-88430696 GGCGGGCAGGTGCGGCTCCCTGG + Intronic
1142237142 16:88927690-88927712 GGCGGAAGGGGGATCATCCCAGG - Intronic
1150346093 17:64405804-64405826 GGCAGAAAGGAGCTGATCTGGGG + Intronic
1150444636 17:65219191-65219213 GGTGGAAAAGAGCTGATACCTGG - Intronic
1151398909 17:73842984-73843006 TGCCGAGAGGTGCTGTTCCCAGG - Intergenic
1151578157 17:74963156-74963178 GGAGGACAGGGGCTGAGCCCAGG + Intronic
1154346605 18:13548296-13548318 GGTGGAAAGGGGCAGGTCCCTGG - Intronic
1155637910 18:27976893-27976915 GGCTGAAAGGGGATGGTCCCAGG + Intronic
1157792510 18:50545472-50545494 GGCAGAAAAGTGCAGGTCCCTGG + Intergenic
1159161368 18:64646850-64646872 GGTGGAAAGGGGCAGGTCCCCGG - Intergenic
1161367235 19:3887132-3887154 GGGTGACAGGTGCTGATCACTGG + Intronic
1167455327 19:49594744-49594766 GACGGAAAGGTGCTGGAACCCGG - Exonic
1167527663 19:49995002-49995024 GGCTGCAAGGTCCTGGTCCCAGG + Intronic
925033711 2:671250-671272 GCCAGAAAGGTGCTGCACCCTGG + Intronic
926675725 2:15618661-15618683 GGCGGAAGGGGGCTAGTCCCCGG - Intronic
927613598 2:24566639-24566661 GGCAGAAAGGGGCAGGTCCCTGG - Intronic
928832337 2:35502337-35502359 GGGGGAAAGTTTCTGATCCTAGG - Intergenic
930971200 2:57397672-57397694 GGCAGAAAGGGGCAGGTCCCCGG - Intergenic
931185019 2:59941403-59941425 GAAGGAAAGATGCTCATCCCTGG + Intergenic
932869241 2:75380575-75380597 GGCGGAAAGGGGTGGGTCCCTGG + Intergenic
933201709 2:79457956-79457978 GAGGGAAGGGTGCTGATGCCAGG - Intronic
933606523 2:84389842-84389864 GGTGGAAAGGGGCACATCCCTGG - Intergenic
934990463 2:98916860-98916882 GAAGGACAGGTGCTGACCCCGGG - Intronic
939925839 2:148172586-148172608 GGTGGAAAGGGGCAGGTCCCTGG + Intronic
942360725 2:175168582-175168604 GGAGGAAAGGTGGTGAGCTCCGG + Intergenic
943064093 2:183069146-183069168 GGTGGAAAGGGGCAGGTCCCTGG + Intergenic
943669777 2:190648820-190648842 GGCGGGAAGGGGCCGAGCCCCGG + Intronic
945143699 2:206714585-206714607 GGCGGAGAGAGGCTGATGCCTGG + Intronic
946281810 2:218671518-218671540 GGCGGAAAAAGGCTGATCCAAGG + Intronic
946811481 2:223530397-223530419 GGCAGACAGGGGCAGATCCCTGG + Intergenic
948334941 2:237200532-237200554 GGTGGAAAGGGGCTGGTTCCTGG - Intergenic
949033744 2:241807397-241807419 GGAGGGAAGGTGCTCTTCCCGGG - Intergenic
1170069450 20:12349283-12349305 GGGGCAATGGTGCAGATCCCAGG - Intergenic
1170134266 20:13055762-13055784 GCCTCACAGGTGCTGATCCCAGG - Intronic
1172621705 20:36321725-36321747 GGGGGAAAGGTGGGGGTCCCAGG + Intronic
1175608036 20:60327608-60327630 GGAGGGAAAGTGCTGATCCCGGG + Intergenic
1176239498 20:64069398-64069420 GGAGGAAATGTGGTGATCCTCGG - Exonic
1181636887 22:24178677-24178699 GGCGGAGAGTTGCTGTCCCCAGG + Intergenic
1183004470 22:34889861-34889883 GGCAGCAAGGTCCTGAGCCCTGG - Intergenic
1185142871 22:49113044-49113066 GGCTGGAAGGTTCTGGTCCCTGG + Intergenic
953766541 3:45747395-45747417 GGCAGAAAGGGGCGGGTCCCTGG + Intergenic
954314131 3:49792012-49792034 GGGTGAATGGTGCTGATTCCTGG - Intronic
955071675 3:55577071-55577093 GGTGGAGAGGGGCTGATCGCAGG - Intronic
955111914 3:55958501-55958523 GGCAGAAAGGGACAGATCCCTGG - Intronic
955650801 3:61191892-61191914 CGCGGAATGGGGCTCATCCCTGG - Intronic
957665348 3:83218583-83218605 GGCGGAAAGGGGCGGGTGCCTGG - Intergenic
957730321 3:84125703-84125725 GGCAGAAAGGTGCGGGTCCCTGG + Intergenic
960011161 3:112835616-112835638 GGCAGAAAGGTGCAGGCCCCTGG - Intronic
962901606 3:139766575-139766597 GGCCCAAAGGTGCTGAGCCTGGG + Intergenic
967390475 3:188949369-188949391 GCAGGAAGGGTGCTGATGCCAGG - Intronic
968142983 3:196273866-196273888 GGCGGAAATGGGCGGGTCCCTGG - Intronic
969897968 4:10322694-10322716 GGTGGAAAGGCGTTGATCTCTGG + Intergenic
974285152 4:59855843-59855865 GGCGGAAAGGGGTGGGTCCCTGG - Intergenic
975110079 4:70613593-70613615 GCTGGAAAGCTGCTGAACCCTGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
976097839 4:81528120-81528142 GGTGGCAAGGGGCAGATCCCTGG - Intronic
978466724 4:109016438-109016460 GGCGGAAAGGGGCGGGTCCCTGG + Intronic
980701927 4:136442560-136442582 GGAGGAAGGGTGCAGGTCCCTGG + Intergenic
985926403 5:3022960-3022982 GGAGGAAAGGAGCTCATCACAGG - Intergenic
986288543 5:6378895-6378917 GGCAGGCAGGCGCTGATCCCAGG - Intergenic
986308219 5:6531399-6531421 GGCAGAAAGGTTCTAATCCTAGG + Intergenic
987537695 5:19208986-19209008 GGCAGAAAGGGGCAGGTCCCTGG + Intergenic
987875397 5:23674817-23674839 GGCAGAAAGGGGCAGGTCCCTGG + Intergenic
993192031 5:84695622-84695644 AGAGGGAAGTTGCTGATCCCAGG + Intergenic
994692396 5:103034752-103034774 GGCAGAAAGGGGCAGGTCCCTGG - Intergenic
995199241 5:109409224-109409246 GGCGGAAAGGTGCTGATCCCGGG + Intronic
995386594 5:111595968-111595990 GGCAGAAAGGGGCAGGTCCCTGG + Intergenic
995638205 5:114219740-114219762 GGCAGAAAAGGGCAGATCCCTGG - Intergenic
997042826 5:130277994-130278016 GGCCGAAAGGAGCAGGTCCCTGG - Intergenic
997370212 5:133354807-133354829 GGTGGAAAGATGGTGCTCCCGGG - Intronic
1001258166 5:170201130-170201152 GGAGGGAGGGTGCTGAGCCCTGG + Intergenic
1002462364 5:179380784-179380806 AGCTGAAAGGTGCTGAGACCAGG + Intergenic
1004009155 6:11665105-11665127 GGTGGAAAGATGCTGGTGCCAGG + Intergenic
1005622928 6:27636713-27636735 GGCGGAGTGGTGCTGGTCCATGG + Intergenic
1005637405 6:27765235-27765257 GGTGGAAATGTTCTGATTCCTGG + Intergenic
1006463812 6:34179142-34179164 GGTGGAAAGGGGTGGATCCCTGG - Intergenic
1011518760 6:88181361-88181383 GGAGGAAAGGAGATGATCCAGGG - Intergenic
1014586546 6:123204216-123204238 GGCAGAAAGCTGCTTTTCCCAGG + Intergenic
1017420537 6:154268079-154268101 GGCGGAAGGGGGCAGGTCCCTGG - Intronic
1017880622 6:158560281-158560303 GGCCGAAAGTTGGGGATCCCTGG + Intronic
1018226956 6:161637903-161637925 GGGGCAAAGGTCTTGATCCCAGG + Intronic
1019126827 6:169846246-169846268 GGGTGCAAGGTGCTGTTCCCTGG - Intergenic
1022226134 7:28365399-28365421 GGAGGAAAGGTGATAATTCCGGG - Intronic
1022342896 7:29485758-29485780 GGTGGAAAGATGATGATTCCTGG + Intronic
1024697206 7:51869887-51869909 GGCGTAAAGGTGCAGGTCACAGG - Intergenic
1027995776 7:85423880-85423902 GGCAGAAAGGGGTGGATCCCTGG + Intergenic
1030270068 7:107661154-107661176 GGAGGAGAGGTGCAGACCCCCGG - Intronic
1031837041 7:126691033-126691055 GGTGGAAAGGGGCAGTTCCCCGG - Intronic
1032098536 7:128953250-128953272 TGGGGTAATGTGCTGATCCCTGG + Intergenic
1035584837 8:764155-764177 TGCGGCACGGTGCTGAGCCCTGG - Intergenic
1041755727 8:61311382-61311404 GGCAGAAAGCAGCTGAGCCCTGG - Intronic
1041956035 8:63558879-63558901 GGCAGAAAGGGGCAGGTCCCCGG + Intergenic
1043533040 8:81171685-81171707 GGTGGAAAGGGGCGGGTCCCTGG - Intergenic
1044053775 8:87542732-87542754 GGTAGAAAGGGGCTGGTCCCTGG - Intronic
1046140406 8:110083470-110083492 GGTGGAAAGGGGCTGGTCCATGG + Intergenic
1046492025 8:114966145-114966167 GGAGGTAATCTGCTGATCCCTGG - Intergenic
1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG + Intronic
1048339142 8:133525529-133525551 GGCAGAAAGGGGCAGGTCCCAGG - Intronic
1048693072 8:136989582-136989604 GGTGGAAAGGGGCAGGTCCCAGG - Intergenic
1052680642 9:31687245-31687267 GGAGGAAAAGTGTTGATCCTAGG - Intergenic
1052786341 9:32831732-32831754 GCCTGAAAGGAGCTGAGCCCGGG + Intergenic
1056994455 9:91443358-91443380 GGCAGAAAGGGGCTGTTCCCTGG - Intergenic
1057042095 9:91855446-91855468 GGCTGAAAAGTCCTGATCCCAGG + Intronic
1058280111 9:103103490-103103512 GGTAGAAAGGGGCTGATCCCTGG + Intergenic
1059518147 9:114914757-114914779 GGGGGAAAGGTTCTCCTCCCAGG + Intronic
1061258065 9:129464264-129464286 GGTGGGCAGGTGCGGATCCCAGG + Intergenic
1061743258 9:132722591-132722613 GGTGGAAAGGGGCAGGTCCCTGG - Intergenic
1061774177 9:132949594-132949616 GGCGGGACTGTGCTGGTCCCTGG + Intronic
1198842909 X:140878355-140878377 GGTGGCAAAGTGATGATCCCAGG + Intergenic
1199998933 X:153046565-153046587 GGAGGAAGGGTGCTGTCCCCGGG + Intergenic