ID: 995211960

View in Genome Browser
Species Human (GRCh38)
Location 5:109550932-109550954
Sequence AAGCCATTCAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6124
Summary {0: 1428, 1: 1886, 2: 1423, 3: 807, 4: 580}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211960_995211963 3 Left 995211960 5:109550932-109550954 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 995211963 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
995211960_995211966 18 Left 995211960 5:109550932-109550954 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 995211966 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
995211960_995211967 24 Left 995211960 5:109550932-109550954 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 995211967 5:109550979-109551001 GGGCAATAAAGTCCAGGCTGAGG No data
995211960_995211964 4 Left 995211960 5:109550932-109550954 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211960 Original CRISPR AAGCCATTCAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr