ID: 995211961

View in Genome Browser
Species Human (GRCh38)
Location 5:109550957-109550979
Sequence CATATGGCTATCAGCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211961_995211967 -1 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211967 5:109550979-109551001 GGGCAATAAAGTCCAGGCTGAGG No data
995211961_995211973 28 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data
995211961_995211972 27 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211972 5:109551007-109551029 GGTGGAAATGAGGAACTTGTTGG No data
995211961_995211968 6 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211968 5:109550986-109551008 AAAGTCCAGGCTGAGGTTTCAGG No data
995211961_995211971 17 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211971 5:109550997-109551019 TGAGGTTTCAGGTGGAAATGAGG No data
995211961_995211966 -7 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211966 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data
995211961_995211969 9 Left 995211961 5:109550957-109550979 CCCAAAATGCTGATAGCCATATG No data
Right 995211969 5:109550989-109551011 GTCCAGGCTGAGGTTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211961 Original CRISPR CATATGGCTATCAGCATTTT GGG (reversed) Intergenic
No off target data available for this crispr