ID: 995211962

View in Genome Browser
Species Human (GRCh38)
Location 5:109550958-109550980
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211962_995211968 5 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211968 5:109550986-109551008 AAAGTCCAGGCTGAGGTTTCAGG No data
995211962_995211972 26 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211972 5:109551007-109551029 GGTGGAAATGAGGAACTTGTTGG No data
995211962_995211969 8 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211969 5:109550989-109551011 GTCCAGGCTGAGGTTTCAGGTGG No data
995211962_995211967 -2 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211967 5:109550979-109551001 GGGCAATAAAGTCCAGGCTGAGG No data
995211962_995211971 16 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211971 5:109550997-109551019 TGAGGTTTCAGGTGGAAATGAGG No data
995211962_995211973 27 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211973 5:109551008-109551030 GTGGAAATGAGGAACTTGTTGGG No data
995211962_995211966 -8 Left 995211962 5:109550958-109550980 CCAAAATGCTGATAGCCATATGG No data
Right 995211966 5:109550973-109550995 CCATATGGGCAATAAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211962 Original CRISPR CCATATGGCTATCAGCATTT TGG (reversed) Intergenic