ID: 995211964

View in Genome Browser
Species Human (GRCh38)
Location 5:109550959-109550981
Sequence CAAAATGCTGATAGCCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995211960_995211964 4 Left 995211960 5:109550932-109550954 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995211964 Original CRISPR CAAAATGCTGATAGCCATAT GGG Intergenic
No off target data available for this crispr